Table 2.
List of most abundant miRNAs in purified S. mansoni exosomes.
| miR namea | miR sequence | Norm readsb exosome | Norm reads whole worm |
|---|---|---|---|
| sma-miR-125b_R-1c | TCCCTGAGACTGATAATTGCT | 43,394 | 49,431 |
| sma-bantam d | TGAGATCGCGATTAAAGCTGGT | 13,148 | 7,495 |
| sma-miR-71a_R + 1 | TGAAAGACGATGGTAGTGAGAT | 12,322 | 12,408 |
| sma-miR-125a | TCCCTGAGACCCTTTGATTGCC | 12,075 | 33,572 |
| sma-miR-36-3p | CCACCGGGTAGACATTCATTCGC | 8,977 | 4,146 |
| sma-miR-10-5p | AACCCTGTAGACCCGAGTTTGG | 3,281 | 19,497 |
| sma-miR-61_R + 1 | TGACTAGAAAGTGCACTCACTTC | 3,145 | 7,471 |
| sma-miR-2a-3p_R-1 | TCACAGCCAGTATTGATGAAC | 2,198 | 6,603 |
| sme-lin-4-5p_ | TCCCTGAGACCTTAGAGTTGT | 1,893 | 5,902 |
| sja-miR-2162-3p | TATTATGCAACGTTTCACTCT | 1,794 | 3,246 |
| sja-miR-277_R + 2 | TAAATGCATTTTCTGGCCCGTT | 653 | 1,354 |
| PC-5p-12974_124 e | GAGAGATTAAGACTGAACGCC | 580 | 298 |
| sja-miR-277_R + 1 | TAAATGCATTTTCTGGCCCGT | 532 | 1,717 |
| PC-3p-8606_176 | ACGGGCTTGGCAGAATTAGCGGGG | 304 | 167 |
| PC-5p-1634_720 | TCCCTGAGACCTTAGAGTTGTCT | 275 | 595 |
| sme-mir-749-p5 | GTCCGGGGTGCAGGCTTC | 275 | 188 |
| sma-let-7 | GGAGGTAGTTCGTTGTGTGGT | 254 | 3,535 |
| sma-miR-71b-5p | TGAAAGACTTGAGTAGTGAGACT | 243 | 254 |
| PC-5p-15294_107 | ACACTGCGAGGCATTGAAT | 207 | 563 |
| PC-3p-8590_176 | GAGATGGATAGTGGCTAGCATTT | 190 | 39 |
| PC-5p-10382_150 | CCTCCGGAATCCCATAGTACT | 160 | 156 |
| sma-miR-3479-3p | TATTGCACTAACCTTCGCCTTG | 140 | 1,545 |
| PC-5p-14055_115 | TGGCGCTTAGTAGAATGTCACCG | 121 | 200 |
| PC-5p-1776_672 | TGATGGATGTAGTATAGG | 117 | 436 |
| sja-miR-3492 | ATCCGTGCTGAGATTTCGTCT | 111 | 42 |
aOnly the most abundant exosomal miRNAs (>100 reads) are shown. A complete list of all the miRNAs that were detected is provided in Table S2. bNormalized (“norm”) reads were calculated after adjustment for the size of the library, as described in the Methods; cThe suffix R followed by a negative number indicates that the read sequence is shorter than the annotated miRNA in miRbase by one (R-1) or two nucleotides (R-2) at the 3′ end. Conversely, R + 1, R + 2 show that the read sequence is longer than the annotate miRNA by one or two nucleotides; dmiRNAs indicated by bold-face printare present at the same or higher levels in exosomes compared to whole worms. eThe prefix PC (potential candidate) is used to describe novel miRNA sequences.