Table 1.
Oligonucleotide primers and amplification conditions used in this study for the molecular detection of gastroenteritis viruses
| Virus | Target region | Rounds of PCR | Sense | Primer name | Sequence 5′–3′ | Cycling protocol1 | Nucleotide position | Amplicon size (bp) | Reference |
|---|---|---|---|---|---|---|---|---|---|
| Calicivirus | RNA-dependent RNA polymerase |
1st | − | 289H | TGACGATTTCATCATCACCATA | 4865–4886a | 34 | ||
| − | 289I | TGACGATTTCATCATCCCCGTA | A | 4865–4886a | 319 | ||||
| + | 290YM | GATTACTCCAGGTGGGAYTCMAC | 4568–4590a | In this study | |||||
| Adenovirus | Hexon | 1st | + | hexAA1885 | GCCGCAGTGGTCTTACATGCACATC | B | 18,858–18,883b | 301 | 35 |
| − | hexAA1913 | CAGCACGCCGCGGATGTCAAAGT | 19,136–19,158 | ||||||
| Astrovirus | ORF-1 | 1st | + | MON340 | CGTCATTATTTGTTGTCATACT | C | 1182–1203 | 289 | 36 |
| − | MON348 | ACATGTGCTGCTGTTACTATG | 1450–1470 | ||||||
| 2nd | + | MON394d | GARATCCGTGATGCTAATGG | D | 1250–1269 | 220 | In this study | ||
| − | MON348 | ACATGTGCTGCTGTTACTATG | 1450–1470 | 37 | |||||
| Aichi virus | 3C-3D | 1st | + | 6261 | ACACTCCCACCTCCCGCCAGTA | E | 6261–6282c | 519 | 38 |
| − | 6779 | GGAAGAGCTGGGTGTCAAGA | 6760–6779 | ||||||
| Klassevirus | 2C | 1st | + | LG0098 | CGTCAGGGTGTTCGTGATTA | F | 4463–4482 | 345 | 27 |
| − | LG0093 | AGAGAGAGCTGTGGAGTAATTAGTA | 4783–4807 | ||||||
| Enterovirus | 5′NTR2 | 1st | + | EV1 | CGGCCCCTGAATGCGGC | G | 454–470 | 194 | 39 |
| − | EV2 | CACCGGATGGCCAATCCA | 630–647 | ||||||
| Picobirnavirus | + | PicoB25 | TGGTGTGGATGTTTC | 665–679d | 201 | ||||
| RNA-dependent RNA polymerase |
Multiplex PCR |
− | PicoB43 | ARTGYT GGTCGAACTT | H | 850–865d | 40 | ||
| + | PicoB23 | CGGTATGGATGTTTC | 685–699e | 369 | |||||
| − | PicoB24 | AAGCGAGCCCATGTA | 1039–1053e |
1Cycling conditions for the PCRs were as follows: A = 94 °C for 2 min, 40 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min, and a final elongation at 72 °C for 10 min; B = 94 °C for 4 min, 40 cycles of 92 °C for 1.5 min, 55 °C for 1.5 min, 72 °C for 2 min, and final elongation at 72 °C for 10 min; C = 94 °C for 5 min, 40 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s; and final elongation at 72 °C for 10 min; D = 94 °C for 2 min, 30 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s, and final elongation at 72 °C for 10 min; E = 95 °C for 1 min, 40 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min and a final elongation at 72 °C for 10 min; F = 94 °C for 2 min, 40 cycles of 94 °C for 30 s, 56◦C for 30 s, 72 °C for 1 min, and final elongation at 72 °C for 10 min; G = 94 °C for 2 min, 40 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min, and a final elongation at 72 °C for 7 min. H = 94 °C for 3 min, 40 cycles of 94 °C for 1 min, 42 °C for 1 min, 72 °C for 1 min, and a final elongation at 72 °C for 10 min
25′nontranslated region
aNumbering given according to positions in Norovirus GI, complete genome (NC_001959.2)
bSequence position refers to the Ad2 hexon region. The primers used allow detecting the 47 human adenovirus serotypes
cSequence position refers to Aichi virus genomic RNA, Ac. N. AB010145.1
dSequence position refers to the 1-CHN-97 strain (Genogroup I)
eSequence position refers to the 4-GA-91 strain (Genogroup II)