. 2018 Feb 23;13(2):e0192725. doi: 10.1371/journal.pone.0192725

Table 1. Sequence differences of VAC-BAC clones no. 3 and no. 4 from authentic LC16m8 except for the EGFP-BAC region.

Position	Sequence		Affected ORF
Position	Genbank reference	VAC-BAC clones	Affected ORF
6222–6243	`GGTAGACGAAGGTTAACCTGAT`	deleted	001R for m8
162321	T	A	A53R (S11T) for CPN, A54L (R21S) for CPN^*, A ORF T (S11T) for CPN

*; Vaccinia virus Copenhagen strain (Genbank accession no. M35027)