Skip to main content
. 2018 Feb 23;13(2):e0192725. doi: 10.1371/journal.pone.0192725

Table 2. Sequence variants in the ITR regions from the stock of the authentic LC16m8.

ITR right
no. of clones (% of abundance)
Present* Absent*
ITR left Present 6 (26%) 15 (65%)
Absent 0 (0%) 2 (9%)

*; The sequence (GGTAGACGAAGGTTAACCTGAT) is present or absent in the viral genome.