Skip to main content
. 2018 Mar 1;13(3):e0193682. doi: 10.1371/journal.pone.0193682

Table 1. Nucleotide and amino acid differences from the CV777 reference sequence AF353511.

Region Nucleotide
(nt)
AF353511
nt / aa
ANSES
nt / aa
WBR
nt / aa
DTU
nt / aa
APHA
nt / aa
IZSLER
nt / aa
FLI
nt / aa
5'-UTR 8 A G ** G
28 A ** G
72 A Del Del Del Del Del Del
82–85 TCCT Del Del Del Del Del Del
ORF1a/1b 3433 A / E Del#
3434 G / E Del#
3435 T / S Del#
3436 C / S Del#
3437 T / S Del#
3438 G / E C / Q Del#
4102 T / V Y / (A/V)
4284 G / G A / G
4767 G / A T / S
5170 A / E G / G
6607 T / L C / Silent
7941 A / S G / G
9179 C / Y T / Silent
10715 T / A Y / Silent
11103 G / A Y / (A/S)
13594 T / V G / Silent
13917 T / V G / G G / G G / G
18113 A / M G / V
20015 A / I G / V
Spike (S) 20887 G / G A / S A / S
20984 T / I C / T C / T
21348 T / N Y / Silent
21529 C / H T / Y
21680 A / N G / S
21805 C / P T / S
22145 C / S T / L T / L
22535 A / E G / G
23771 C / A T / V
23800 C / H G / D
24416 C / T A / N
24757 T / Y C / H
Spike/ ORF3 24765–24816 * Del Del
ORF3 25201 A / I Del
25202 T / I Del## Del
25203 T / I Del## Del
Env (E) 25655 G / S K / (S/I)
Mem (M) 25713 T / V C / A
25992 G / R A / H

* 52 nt deletion at Spike/ORF3 junction: TTTTGAAAAGGTCCACGTGCAGTGATGTTTCTTGGACTTTTTCAATACACGA. Stop codon of Spike and start codon of ORF3 indicated with underline and italics, respectively.

** the 5´-terminal region of the Br1/87 (DTU) sequence is rearranged upstream of nt 35.

#The 6 nt deletion modifies 3 codons and results in alteration of the encoded amino acid sequence from..NVESEV.. to..NVEV.., i.e. 2 amino acids are deleted.

## The loss of 2 nt results in the formation of a new termination codon that is predicted to result in the truncation of the ORF3 protein (see text for details).

Shared changes are highlighted in grey. Synonymous nt changes are indicated as “silent”. The nt identifier Y is for pyrimidines (C or T) while K denotes G or T.