Stem Cell Secretome and Its Effect on Cellular Mechanisms Relevant to Wound Healing

Abstract

Stem cells introduced to site of injury primarily act via indirect paracrine effects rather than direct cell replacement of damaged cells. This gives rise to understanding the stem cell secretome. In this study, in vitro studies demonstrate that the secretome activates the PI3K/Akt or FAK/ERK1/2 signaling cascades and subsequently enhances the proliferative and migratory abilities of various types of skin cells, such as fibroblasts, keratinocytes, and vascular epithelial cells, ultimately accelerating wound contraction. Indeed, inhibition of these signaling pathways with synthetic inhibitors resulted in the disruption of secretome-induced beneficial effects on various skin cells. In addition, major components of the stem cell secretome (EGF, basic FGF, and HGF) may be responsible for the acceleration of wound contraction. Stimulatory effects of these three prominent factors on wound contraction are achieved through the upregulation of PI3K/Akt or FAK/ERK1/2 activity. Overall, we lay the rationale for using the stem cell secretome in promoting wound contraction. In vivo wound healing studies are warranted to test the significance of our in vitro findings.

Graphical Abstract

The stem cell secretome, which contains various growth factors, especially EGF, bFGF, and HGF, accelerates wound healing by stimulating the proliferative and migratory abilities of existing skin cells through multiple signaling pathways. The stem cell secretome might therefore be a promising alternative for the treatment of cutaneous wounds.

Introduction

Skin wound healing is a well-orchestrated process involving the reconstitution of various cell types in the epidermal and dermal layers. In serious chronic conditions such as severe burns and diabetes, the wound healing process is delayed or fails to appropriately restore the normal structure and function of injured tissue, causing ulceration or other changes in the skin. This led to the discovery of more advanced therapeutic options such as gene therapy,¹ growth factor therapy,² platelet-rich plasma (PRP) therapy,³ stem cell-based therapy,⁴ and tissue engineering.⁵ Among these approaches, stem cell-based therapy has recently emerged as an attractive option for cutaneous wounds because of the therapeutic potential of these cells.⁶ Despite many promising results, some limitations must be considered. One of the major challenges of stem cell-based replacement therapy is the low survival rate after transplantation.⁷ In addition, tumor-initiating cells possess many characteristics similar to those of normal stem cells.⁸ Furthermore, a recent study demonstrated that the mutation of normal stem cells within tissues may contribute to the origin of cancer-initiating cells.⁹ The complex set of secreted molecules from stem cells, including growth factors and cytokines, is broadly defined as the stem cell secretome. The administration of the stem cell secretome for severe cutaneous wounds may represent a promising approach to addressing the limitations of viable transplantation of replacement cells.

Direct evidence that the secretome plays important roles in promoting the regeneration has been observed in a large number of studies on cardiovascular,¹⁰ liver¹¹ and lung,¹² and renal¹³ injury. Similarly, stem cell-conditioned medium has been applied in many pre-clinical studies as an acceptable alternative for therapies using replacement cells to treat wound healing.14, 15, 16, 17 This has encouraged the use of the stem cell secretome to accelerate the repair process in skin-wound regeneration. Nevertheless, three fundamental questions regarding their therapeutic effects remain unanswered. (1) What are the most effective factors responsible for the observed therapeutic effects in the secretome? (2) What are the underlying molecular mechanisms driving the therapeutic impact of the secretome? (3) How does the secretome regulate various functions of dermal cellular components during the repair process?

We therefore investigated whether the secretome isolated from human adipose tissue-derived mesenchymal stem cells could accelerate cutaneous wound healing in vitro and in vivo. Importantly, we also demonstrated that the secretome enhanced the proliferative and migratory abilities of various cellular components of the dermis, such as dermal fibroblasts, keratinocytes, and endothelial cells, in vitro by activating PI3K/Akt and FAK-ERK1/2 signaling. Here, we were able to identify and quantify 40 secreted proteins present in the stem cell secretome by using a growth factor array. Among them, the elevated levels of epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), and hepatocyte growth factor (HGF) were found to be related to the secretome-mediated wound healing, and the roles of these three major components in the proliferative and migratory capability were further investigated in multiple types of skin cells in vitro. Based on these results, we have demonstrated that the stem cell secretome, which contains various growth factors, especially EGF, bFGF, and HGF, accelerates wound healing by stimulating the proliferative and migratory abilities of existing skin cells through PI3K/Akt or FAK-ERK1/2 signaling. The stem cell secretome might therefore be a promising alternative for the treatment of cutaneous wounds.

Results

Stem Cell Secretome Accelerates Cutaneous Wound Healing In Vivo

We first isolated mesenchymal stem cells from human adipose tissues (Figure S1A) and then characterized their biological properties by using multiple negative and positive surface markers for mesenchymal stem cells (Figure S1B). Their capacity to differentiate into multiple lineages was evaluated by inducing adipogenic and osteogenic differentiation (Figure S1C). To avoid their limited expansion capacity and to improve the yield of the stem cell secretome, we established immortalized mesenchymal stem cells by transfection of the SV40 large T antigen, which was not fully transformed but enhanced growth potential,¹⁸ to obtain more reliable and reproducible results. Successfully immortalized mesenchymal stem cells formed rapidly growing colonies with normal phenotypes (Figure S2A). The expression of the SV40 large T antigen was confirmed by immunocytochemistry (Figure S2B) and western blotting (Figure S2C). Our immortalized mesenchymal stem cells retained normal stem cell characteristics (Figure S2D) and multilineage differentiation capacity (Figure S2E). The stem cell secretome was isolated according to the procedure previously described by Baglio et al.¹⁹ Next, we investigated whether the secretome accelerates skin regeneration in vivo by applying it to regions of cutaneous wounds on mice. The secretome (30 μg/mL)-treated groups exhibited accelerated wound healing (Figure 1A) with minimal scar formation (Figure 1B). Furthermore, we also conducted the additional set of experiments with human fibroblast secretome as a control for human proteins. As expected, stem cell secretome markedly increased rate of wound healing compared to human fibroblast secretome (Figures S3A and S3B). After stem cell secretome treatment, tissues from the wound edge and healing region were examined via histology. We found marked increases in epidermal and dermal thickness in wounds treated with the stem cell secretome compared to the group treated with mock secretome or to the non-treated control group (Figure 1C). Consistent with those of a previous non-stented cutaneous wound model, morphometric quantification of scar tissue revealed a significant reduction in secretome-treated mice when compared with controls (Figures S4A and S4B). Furthermore, we also found marked increases in vascularized granulation tissue in wounds treated with the stem cell secretome compared to the group treated with mock secretome or to the non-treated control group (Figure S4C). Histological analysis revealed that the secretome accelerates the proliferation of keratinocytes at the wound margin and migration above the granulation tissue (Figure S4D). Masson’s trichrome (Figure S5A)- and Picrosirius red (Figure S5B)-stained sections showed significantly increased dermal collagen layers in wounds treated with the stem cell secretome compared to the group treated with mock secretome or to the non-treated control group. (Figures S5A and S5B). Additionally, to provide more accurate quantification of endothelial cell density in stented cutaneous wound model, we conducted the additional analysis of vascular endothelial cell marker expression with fluorescent probes CD31. Consistent with those of a previous non-stented cutaneous wound model, CD31 levels of in the secretome-treated group was significantly higher than in the mock-secretome-treated group (Figure S4E). We also found significantly increased expression of the proliferation marker Ki67 in wounds treated with the stem cell secretome (Figure 1D). Previous in vitro studies suggest that IL-1β promotes wound healing by stimulating fibroblast and keratinocyte growth²⁰ or infiltrating of immune cells into wound site.²¹ We therefore conducted the additional set of experiments with IL-1β-stimulated stem cell secretome in stented cutaneous wound model to compare their effects on wound healing. Importantly, IL-1β-stimulated stem cell secretome more effectively accelerated wound healing (Figure S6A) with minimal scar formation (Figure S6B) than non-stimulated stem cell secretome. The endothelial cell density in the dermis was also clearly increased in the stem cell-secretome-treated group compared with the mock-secretome- and non-treated groups (Figure 1E). In the injury sites, the average expression of CD31 (a vascular endothelial cell marker) in the secretome-treated group was significantly higher than in the mock-secretome-treated group (Figure 1F), indicating more angiogenesis and vascularization with the secretome treatment. Monocytes and macrophages recruited to the healing regions play diverse roles in repair by modulating the inflammatory response.²² We therefore also stained for the monocyte/macrophage marker CD68 and found a significant increase in CD68⁺ cell numbers in secretome-treated wounds compared to the control groups (Figure 1G). To further evaluate the effect of stem cell secretome on M2 macrophage recruitment to the wound sites, we stained for the M2 macrophage marker CD163 and found a markedly increased M2 macrophage infiltration into the wound sites (Figure S7A). Taken together, these results indicate that the stem cell secretome accelerates the wound healing process by stimulating dermal thickening, angiogenesis, and immune cell recruitment. It is also important to compare adipose-tissue-derived stem cell secretome activities with another well-known adult stem cell-derived secretome. Importantly, adipose-tissue-derived stem cell secretome effectively accelerated wound healing (Figure S8A) with minimal scar formation (Figure S8B), similar to that of umbilical-cord-blood-derived stem cell secretome. We also found marked increases in epidermal and dermal thickness in wounds treated with both adipose-tissue-derived and umbilical-cord-blood-derived secretomes (Figure S8C).

Figure 1.

The Effects of the Stem Cell Secretome on Cutaneous Wound Healing In Vivo

Wounds were created in the dorsal skin of animals by using a biopsy punch to cut through both the epidermal and dermal layers. Representative images of skin wound sites taken 2 and 5 days post-wounding. The secretome (30 μg/mL)-treated wound showed resurfacing of over 90% of the initial wound area on day 5 after injury, while the wounds treated with PBS or mock secretome were only beginning to heal (A). Scar formation was then monitored over the subsequent 14 days (B). Histopathological analysis of wound sites showed that stem cell-secretome-treated mice revealed significant increases in epidermal and dermal thickness compared to mice treated with PBS or mock secretome at day 5 (C). Green arrow, epidermis length; red arrow, dermis length. The increased numbers of proliferating cells in response to the stem cell secretome were detected using an antibody that recognizes the nuclear antigen Ki67 in actively dividing cells (D). Histopathological examination of the skin-wound site treated with the stem cell secretome revealed an increase in newly formed vessels after 5 days (yellow arrow) (E). The average number of vessel cells was measured using a specific antibody for the endothelial cell marker CD31 (F). Recruited monocytes and macrophages at sites of injury were detected by staining for the monocyte and macrophage marker CD68 (G). DAPI staining was used to label the nuclei. The results are presented as the mean ± SD from three independent experiments.

The Secretome Promotes Proliferative and Migratory Abilities of Various Types of Skin Cells

The proliferation and migration of dermal cellular components such as fibroblasts, keratinocytes, and vascular endothelial cells are essential for the cutaneous repair/regeneration process.23, 24 We therefore investigated how the stem cell secretome accelerates the wound healing process by evaluating the effect of the secretome on the proliferative and migratory abilities of multiple types of dermal cell. Importantly, the invasion (Figure 2A) and migration (Figure 2B) capabilities of these cells were significantly enhanced by exposure to the stem cell secretome. To further confirm the stimulatory effect of the secretome on the migratory ability of skin consisting cells, western blotting was used to evaluate the expression levels of MMP-2 and MMP-9, which play important roles in regulating cell migration (Figure 2C). Consistent with this, the expression levels of migration-associated genes, such as Snail1/2, Slug, Twist, and Vimentin, were progressively upregulated and significantly increased in cells treated with the stem cell secretome compared to controls (Figures S9A–S9C). We also evaluated the effect of the stem cell secretome on the proliferation of these cells through a 3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide (MTT) assay for 3 days in vitro. The stem cell secretome treatment significantly increased cell proliferation (Figure 2D) and expression of the proliferation marker Ki67 (Figure 2E) compared to the mock secretome. Taken together, these results suggest that the stem cell secretome may promote wound healing by stimulating the proliferative and migratory abilities of existing skin cells.

Figure 2.

The Effects of the Secretome on the Invasion and Migration of Skin-Consisting Cells

The cell-invasion ability of the dermal cellular components (dermal fibroblasts, keratinocytes, and vascular endothelial cells) was evaluated using a transwell assay. Compared with treatment with the mock secretome, treatment with stem cell secretome (10 μg/mL) significantly decreased the degree of their invasion across the transwell membrane (A). The effects of the stem cell secretome on the migration of skin cells were evaluated using a scratch assay. The migration of cells treated with the stem cell secretome was faster than that of the cells treated with mock secretome (B). The relative expression levels of key positive regulators of cell migration (MMP-2/9) were assessed using western blotting (C). The enhancement of cell viability by stem cell secretome treatment for 72 hr was determined via an MTT assay in three types of skin cells. The cell viability (%) was calculated as the percent of viable cells after treatment with mock secretome (D). The relative expression levels of the nuclear antigen Ki67 in actively proliferating cells were assessed using western blotting (E). β-actin was used as the internal control. The results are presented as the mean values ± SD from three independent experiments.

The Secretome Activates Pro-survival PI3K/Akt and FAK/ERK1/2 Signaling in Skin Cells

To investigate the underlying molecular mechanisms of stem cell-secretome-enhanced wound healing, we examined the effect of stem cell secretome treatment on the PI3K/Akt or FAK/ERK1/2 signaling pathways, which have been associated with cell migration and proliferation. During tissue repair, phosphorylation of PI3K/Akt or FAK/ERK1/2 leads to the enhanced cell proliferation and migration of skin cells,25, 26, 27 suggesting that the stem cell secretome may accelerate cutaneous wound healing by activation these signaling cascades. Therefore, we used western blot analysis to evaluate whether the secretome was sufficient to activate the PI3K/Akt (Figure 3A) or FAK/ERK1/2 (Figure 3B) signaling cascades in multiple types of dermal cells. Importantly, phosphorylation levels of these signaling molecules were significantly increased in secretome-treated cells. Next, to determine whether the blockade of these signaling activities attenuates secretome-mediated proliferative and migratory abilities of skin cells, we evaluated the effect of treatment with the ERK1/2 inhibitor PD98059 or Akt inhibitor V on the cell migration and proliferation with or without secretome treatment. Indeed, treatment with inhibitor V or PD98059 resulted in the disruption of secretome-induced migration (Figures 4A and 4B) and MMP-2/9 expression (Figures 4C and 4D) in dermal cellular components. Consistent with this, the secretome-induced proliferation (Figures 5A and 5B) and expression of the proliferation marker Ki67 (Figures 5C and 5D) were also significantly attenuated by treatment with inhibitor V or PD98059. These results suggest that PI3K/Akt and FAK/ERK1/2 signaling cascades may be involved in the stem cell secretome-induced migration and proliferation of multiple dermal cellular components during tissue repair.

Figure 3.

The Stimulatory Effects of the Stem Cell Secretome on PI3K/Akt or FAK/ERK1/2 Signaling

Serum-starved dermal cellular components (dermal fibroblasts, keratinocytes, and vascular endothelial cells) were stimulated for 30 min with either stem cell secretome or mock secretome (10 μg/mL). Cells were then lysed, and protein contents were analyzed by western blotting using antibodies targeting the phosphorylated forms of PI3K, Akt, and CREB (A) and FAK and ERK1/2 (B). The phosphorylation levels of these signaling molecules were significantly increased in cells treated with the stem cell secretome (A and B). β-actin was used as the internal control. The results are presented as the mean values ± SD from three independent experiments.

Figure 4.

Inhibition of Akt or ERK1/2 Attenuated the Secretome-Induced Migratory Capacity of Skin Cells

Three types of dermal cells (dermal fibroblasts, keratinocytes, and vascular endothelial cells) were treated with 10 μg/mL stem cell secretome alone or concomitantly with 20 μM Akt inhibitor V (A and C) or ERK1/2 inhibitor PD98059 (B and D) for 48 hr, and subsequently, the changes in migratory capacity were measured via the transwell assay and western blotting for MMP-2 and -9. β-actin was used as the internal control. The results are presented as the mean values ± SD from three independent experiments.

Figure 5.

Inhibition of Akt or ERK1/2 Attenuated the Secretome-Induced Proliferative Capacity of Skin Cells

Three types of dermal cells (dermal fibroblasts, keratinocytes, and vascular endothelial cells) were treated with 10 μg/mL stem cell secretome alone or simultaneously with 20 μM Akt inhibitor V (A and C) or ERK1/2 inhibitor PD98059 (B and D) for 48 hr, and subsequently, the changes in proliferative capacity were measured via the MTT assay and western blotting of the nuclear antigen Ki67. β-actin was used as the internal control. The results are presented as the mean values ± SD from three independent experiments.

Proteome Profiler Array Analysis of the Stem Cell Secretome and the Interconnected Signaling Networks of Its Major Components

To identify major secreted factors responsible for the effects of the stem cell secretome on the wound healing process, we used growth factor antibody arrays to analyze the stem cell secretome for multiple common cytokines/growth factors. In duplicate experiments, we assessed the levels of 40 proteins in both the stem cell secretome and the mock secretome. The expression levels of five growth factors, bFGF, EGF, HGF, IGFBP-6, and transforming growth factor β (TGF-β), were elevated substantially, whereas the levels of other factors showed minor increases (Figure 6A). In particular, markedly enhanced levels of the three most prominent factors (EGF, HGF, and bFGF) in the stem cell secretome derived from three different individuals were confirmed by ELISA (Figure 6B). This result suggests that EGF, HGF, and/or bFGF may be responsible for the acceleration of wound healing as main components of the stem cell secretome. Furthermore, we analyzed the activation states of PI3K/Akt or FAK/ERK1/2 signaling and the expression levels of EGF, HGF, and bFGF using GeneMANIA (http://genemania.org) to evaluate these interconnected signaling networks governing proliferation and migration. To find gene interactions, we considered several factors, including co-expression, co-localization, and genetic interactions. The results revealed a strong relationship between the activation state of PI3K/Akt or FAK/ERK1/2 signaling and the expression levels of the three most prominent factors (Figure 6C). We further investigated whether the exposure of skin cells to each prominent factor could mimic the effects of the stem cell secretome on migratory and proliferative abilities. We observed markedly increased migration ability (Figure 7A) in skin cells in response to each prominent factor. Indeed, the expression levels of migration-associated genes (MMP-2 and MMP-9) were significantly increased in cells treated with these factor compared to controls (Figure 7B) in dermal cellular components. Additionally, we also demonstrated that the treatment with each factor significantly increased the proliferation of skin cells (Figure 7C). These results suggest that as major components of the secretome, EGF, HGF, and bFGF can mimic the effects of the stem cell secretome on the accelerated wound healing process.

Figure 6.

Three Major Components (EGF, HGF, and bFGF) of the Secretome Are Associated with PI3K/Akt or FAK/ERK1/2 Signaling Activities

Human growth factor antibody array analysis was performed using mock secretome or stem cell secretome. The membrane was printed with antibodies for 40 growth factors, cytokines, and receptors, with four positive and four negative controls in the upper and lower left corner. Three growth factors (EGF, HGF, and bFGF) were markedly enriched in stem cell secretome compared to mock secretome (A). Increased concentrations of EGF, HGF, and bFGF in stem cell secretome are detected by ELISA (B). Signaling network analysis was performed using GeneMANIA (http://genemania.org) in order to predict the connections between the three growth factors and PI3K/Akt or FAK/ERK1/2 signaling. The results revealed a positive relationship between each of the three prominent factors (EGF, HGF, and bFGF) and PI3K/Akt or FAK/ERK1/2 signaling (C). The results are presented as the mean values ± SD from three independent experiments.

Figure 7.

Three Major Components of the Secretome (EGF, HGF, and bFGF) Can Mimic the Effects of the Stem Cell Secretome

Three types of dermal cells (dermal fibroblasts, keratinocytes, and vascular endothelial cells) were treated with human recombinant EGF (20 μM), HGF (20 μM), or bFGF (20 μM) for 48 hr, and subsequently, the changes in migratory capacity were measured via the transwell assay (A) and western blotting for MMP-2 and -9 (B). The changes in proliferative capacity were measured via the MTT assay (C). β-actin was used as the internal control. The results are presented as the mean values ± SD from three independent experiments.

Stimulatory Effects of the Three Prominent Factors on Wound Healing Are Achieved through the Upregulation of PI3K/Akt or FAK/ERK1/2 Activity

Furthermore, to determine whether the three prominent factors stimulate wound healing by activating PI3K/Akt or FAK/ERK1/2 signaling, we blocked these signaling pathways and then investigated their effects on the proliferative and migratory abilities of skin consisting cells with or without treatment with the three growth factors. Indeed, treatment with Akt inhibitor V resulted in the disruption of migration (Figures S10–S12) and proliferation (Figure S13) induced in dermal cells upon treatment with the three growth factors. Consistent with this, treatment with the ERK1/2 inhibitor PD98059 also significantly attenuated the migration (Figures S14–S16) and proliferation (Figure S17) in response to the three growth factors. These results suggest that the PI3K/Akt and FAK/ERK1/2 signaling cascades may be involved in the migration and proliferation of skin cells in response to major secretome components during tissue repair.

Discussion

Stem cells have received considerable attention for skin repair and regeneration, due to their ability to differentiate into multiple skin cell types.²⁸ However, the primary limitation of replicating stem cell-based therapies for cutaneous wounds is the poor post-transplantation viability at the administration site, which might curtail their therapeutic potential.²⁸ Recent studies suggest that the ability of stem cells to secrete various growth factors and cytokines may be as important to improve wound healing as their transdifferentiation potentials.29, 30 Hence, a number of researchers and clinicians have turned their attention toward paracrine-mediated stem cell therapy instead of cell replacement to promote proper wound healing. Indeed, the secretory factors from adipose tissue-derived stem cells improved wrinkling³¹ and accelerated wound healing.³² These soluble factors stimulate collagen synthesis and migration of dermal fibroblasts by upregulating the transcription of collagen type I, collagen type III, and fibronectin, subsequently promoting skin wound healing. In the present study, we showed that stem cell-secretome-treated groups exhibited accelerated wound healing (Figure 1A) with minimal scar formation (Figure 1B). Importantly, we also observed markedly accelerated wound healing based on the stimulation of dermal thickening (Figures 1C and 1D), angiogenesis (Figures 1E and 1F), and immune cell recruitment (Figure 1G).

The epidermis is the top layer of the skin and is mainly made up of keratinocytes, although it also contains other cell types.³³ The dermis is the lower layer of the epidermis and is mostly composed of fibroblasts, which are responsible for generating connective tissue. During skin wound repair, keratinocytes grow and migrate from the wound edge to restore the barrier function of the skin.³⁴ Dermal fibroblasts play a key role in dermal wound repair by proliferating and subsequently migrating into the wound region.³⁵ In addition, endothelial cell migration for angiogenesis leads to the formation of a dense network of blood vessels during wound healing. Therefore, the proliferation and migration of these skin-forming cells are rate-limiting events in the wound-healing process, but in the cutaneous wound environment, they show decreased proliferative and migratory capacities.36, 37 In this context, we investigated whether the stem cell secretome has the ability to enhance wound healing by activating the proliferation and migration activity of these cells. Indeed, the invasion (Figure 2A) and migration (Figure 2B) capabilities of three types of skin cells were significantly enhanced by stem cell secretome treatment. Furthermore, the secretome treatment significantly increased cell proliferation (Figure 2D) and expression of the proliferation marker Ki67 (Figure 2E). These results suggest that the stem cell secretome may promote wound healing by stimulating the proliferative and migratory abilities of skin cells.

Major soluble factors released from stem cells responsible for therapeutic effects have been investigated in several pre-clinical studies. Stem cells from bone marrow,³⁸ adipose tissue,³⁹ and umbilical cord blood⁴⁰ have been shown to release multiple paracrine factors such as EGF, KGF, and bFGF. These secretory factors promoted keratinocyte migration in vivo and significantly enhanced wound re-epithelialization. Similarly, the impact on wound angiogenesis at the injury site was also related to vascular endothelial growth factor (VEGF), which is secreted by bone marrow⁴¹ and adipose-tissue-derived stem cells.³⁹ In this context, we analyzed stem cell secretome to identify possible paracrine factors that are functionally involved in the acceleration of wound healing processes. Analyses of 40 secreted proteins from the secretome indicated that stem cells secrete a number of regulators of tissue repair, including growth factors, cytokines, and chemokines, specifically bFGF, EGF, HGF, IGFBP-6, and TGF-β (Figure 6A). Among these secreted proteins, markedly enhanced levels of the three most prominent factors (EGF, HGF, and bFGF) in the stem cell secretome were confirmed by ELISA (Figure 6B). Consistent with this, You and Nam⁴² revealed that EGF-releasing stem cells accelerate the wound healing process by increasing fibroblast migration and proliferation. In addition, HGF has previously been shown to exert mitogenic and anti-apoptotic effects on epithelial and endothelial cells.⁴³ HGF-secreting stem cells promote wound healing in the nasal epithelium both in vitro and in vivo but not by directly differentiating into the target tissues.⁴⁴ bFGF is also widely used in accelerating skin regeneration, thereby remarkably alleviating scarring in diabetic wound healing.⁴⁵ Chen et al. demonstrated that FGF secreted by stem cells could accelerate wound healing kinetics in diabetic ulcers.⁴⁶ Our in vitro results consistently showed that all three of these prominent secretory factors can promote migration (Figures 7A and 7B) and proliferation (Figure 7C) of skin cells such as dermal fibroblasts, keratinocytes, and vascular endothelial cells. This suggests that these three factors may be responsible for the acceleration of wound healing as main components of the stem cell secretome by promoting proliferation and migration of major cellular components of human skin.

Generally, the PI3K/Akt⁴⁷ or FAK/ERK1/248 signaling pathways are preferentially activated by mitogens and growth factors in multiple cell types. In the present study, we found that the secretome activated PI3K/Akt and FAK/ERK1/2 signaling in skin cells (Figures 3A and 3B). Blockage of these signaling pathways with specific inhibitors resulted in significant attenuation of the secretome-induced cell migration and proliferation in the responding cells (Figures 4 and 5), suggesting that the secretome exerts its biological activities on the responding cells via the PI3K/Akt and/or FAK/ERK1/2 signaling pathways. Potential reasons for the activation of these signaling pathways include the possibility that the secretome contained certain bioactive factors such as EGF, bFGF, and HGF, which are known to activate the PI3K/Akt and/or FAK/ERK1/2 signaling pathway. Indeed, the protective roles of EGF,⁴⁹ bFGF,⁴⁵ and HGF⁵⁰ in wound healing are believed to be mediated in part by the activation of PI3K/Akt or FAK/ERK1/2 signaling. Consistent with this model, we found that as major components of the secretome, EGF, HGF, and bFGF can mimic the effects of stem cell secretome on the accelerated wound-healing process (Figures 7A–7C). Blockade of PI3K/Akt or FAK/ERK1/2 signaling with specific inhibitors resulted in significant attenuation of the cell migration or proliferation in skin cells in response to each growth factor (Figures S10–S17), suggesting that PI3K/Akt or FAK/ERK1/2 signaling may be involved in the migration and proliferation of dermal cellular components during tissue repair in response to these three growth factors.

Although stem cell-secretome-based therapy has been noted as an alternative strategy to various diseases, several potential challenges for the clinical application of the current findings still exist. One of the major challenges is identifying a specific therapeutic effector of stem cell secretome. Indeed, previous reports suggest that the therapeutic effects are likely mediated by multiple components within the secretome.⁵¹ In addition, the short half-life of isolated secretome and the instability to maintain cytokine activity after administration are other limitations of stem cell-secretome-based therapy. However, a more thorough understanding of the interaction between multiple components and more efficient isolation methods will facilitate the development of effective stem cell-secretome-based therapy for various incurable diseases. In conclusion, we demonstrated the paracrine potential of human adipose-tissue-derived stem cells on skin-wound repair and described the detailed mechanisms by which the stem cell secretome exerts mitogenic and motogenic effects on skin cells, including relevant roles of various therapeutic bioactive factors. Furthermore, while we have confirmed that PI3K/Akt and/or FAK/ERK1/2 signaling may be involved in the migration and proliferation of dermal cellular components during tissue repair in response to stem cell secretome in vitro, whether the secretome exerts its biological activities on the responding cells via these signaling pathways in vivo remains unknown, and this warrants further investigation in future studies.

Materials and Methods

Isolation and Culture of Human Adipose Tissue-Derived Mesenchymal Stem Cells

Human adipose-tissue-derived mesenchymal stem cells were obtained from adipose tissues of breast cancer patients with written informed consent from the patients and approval of the Gachon University Institutional Review Board (IRB No, GAIRB2015-104). All of the human-related experiments were approved and conducted in accordance with the Gachon University Institutional Review Board (IRB No, GAIRB2015-104). Adipose tissue was minced into small pieces, and then the small pieces were digested in DMEM containing 10% fetal bovine serum (FBS) and 250 U/mL type I collagenase for 5 hr at 37°C. The digestion mixture was then filtered through a 40 μm cell strainer. Isolated cells were then cultured in EBM-2 medium (Lonza) with EGM-2 supplements at 37°C and 5% CO₂. Keratinocytes (ATCC PSC-200-011) and vascular endothelia cells (ATCC PSC-100-010) were purchased from ATCC. Keratinocytes were cultured in dermal cell basal medium (ATCC PSC-200-011) with supplement (ATCC PSC-200-040) and 10% FBS. Vascular endothelia cells were cultured in EGM-2 medium (Lonza, CC-4176) with 2% FBS. Human dermal fibroblasts were kindly provided by professor Se-Ran Yang, Kangwon National University, Gangwon, South Korea. Human dermal fibroblasts have been well characterized and shown to retain many of the characteristics of fibroblasts.

Preparation of Stem Cell Secretome

Once stem cells reached 70% confluence in 75 cm² flasks containing complete medium, they were washed twice with 5 mL PBS and incubated with 10 mL DMEM without FBS and antibiotics for 48 hr. After incubation, stem cell-conditioned medium was collected and centrifuged twice at 1,500 rpm for 3 min to eliminate debris and dead cells. Then, the medium was filtered through 0.45 μm syringe filter (Corning, USA). The filtered conditioned medium was mixed with 3 volumes of 100% ethanol and incubated for 1 hr at −20°C. The ethanol conditioning medium was then centrifuged at 2,000 rpm for 15 min at 4°C. The secretome-containing pellet was washed with 70% ethanol and centrifuged at 1,500 rpm for 15 min at 4°C. The supernatant was removed, and the secretome-containing pellet was then carefully re-suspended in distilled water (DW) and used immediately or stored at −80°C. Mock secretome was isolated from cell-, FBS-, and antibiotics-free basal medium (DMEM).

Skin-Wound Healing Assay and Histological Assessment

All of the animal experiments were approved and conducted in accordance with the Institutional Animal Care and Use Committee (IACUC) (LCDI-2016-0083) of the Lee Gil Ya Cancer and Diabetes Institute of Gachon University. Nude mice (7 weeks old, male, body weight 20–25 g) were obtained from Jackson Laboratory. After anesthetization, two full-thickness excisional skin wounds were created on both sides of the dorsal surface using an 8 mm biopsy punch device. A transparent dressing (3M Tegaderm) was applied to cover the wounds after topical application of 30 μg/mL of stem cell secretome or mock secretome. The animals were housed individually. Photos were taken, and wound size was measured on day 0, day 2, day 5, and day 10. After sacrifice, mouse skin tissues were fixed with 10% formalin and used for histological examination and immunofluorescence staining.

In Vitro Cell Migration Assay

Skin cells were plated at 1 × 10⁵ cells/well in 200 μL of culture medium in the upper chambers of transwell permeable supports (Corning Inc., Corning, NY, USA) to track the migration of skin cells. The transwell chambers had 8.0 μm pores in 6.5-mm diameter polycarbonate membranes and used a 24-well plate format. Non-invading cells on the upper surface of each membrane were removed by scrubbing with laboratory paper. Migrated cells on the lower surface of each membrane were fixed with 4% paraformaldehyde for 5 min and stained with hematoxylin for 15 min. Later, the number of migrated cells was counted in three randomly selected fields of the wells under a light microscope at 50× magnification. To calculate the chemotactic index, the number of cells that migrated in response to the stem cell secretome was divided by the number of spontaneously migrating cells (mock secretome).

Scratch Test Assay

Tissue culture dishes (60 mm in diameter) were seeded with 1.0 × 10⁵ cells and maintained until the cell monolayers were confluent. These confluent monolayers were then scratched with a sterile pipette tip to generate a 12-mm-wide area without cells. The cell surface was then washed three times with PBS to remove dislodged cells. The cells were then incubated at 37°C and 5% CO₂ with stem cell secretome or mock secretome for 12 hr. Cells then were fixed with 4% paraformaldehyde for 15 min and washed twice with PBS. Wound closure was monitored by collecting digitized images at 0 and 12 hr after the scratch was made.

Cell Proliferation Assay

The MTT assay was used to determine the proliferative capacity of the stem cell secretome, according to the manufacturer’s protocol. Skin cells (1 × 10⁴ cells/well) were seeded in 96-well plates. After 24 hr of incubation, the cells were treated with stem cell secretome or mock secretome for 72 hr. The viable cells were measured at 570 nm using a VersaMax microplate reader.

Protein Isolation and Western Blot Analysis

The protein expression levels were determined by western blot analysis as previously described.⁵² Cells were lysed in a buffer containing 50 mM Tris, 5 mM EDTA, 150 mM NaCl, 1 mM DTT, 0.01% NP 40, and 0.2 mM PMSF. The protein concentrations of the total cell lysates were measured by using bovine serum albumin as a standard. Samples containing equal amounts of protein were separated via SDS-PAGE and then transferred onto nitrocellulose membranes (Bio-Rad Laboratories). The membranes were blocked with 5% skim milk in Tris-buffered saline containing Tween 20 at room temperature (RT). Then, the membranes were incubated with primary antibodies against β-actin (Abcam, MA, USA, ab189073), MMP-2 (Cell Signaling Technology #4022), MMP-9 (Cell Signaling Technology #13667), total PI3K (Cell Signaling Technology #4292), phospho-PI3K (Cell Signaling Technology #4228), total CREB (Cell Signaling Technology #9197), phospho-CREB (Cell Signaling Technology #9198), total Akt (Cell Signaling Technology #4491), phospho-Akt (Cell Signaling Technology #4060), total-ERK1/2 (Cell Signaling Technology #9012), phospho-ERK1/2 (Cell Signaling Technology #9101), Ki67 (Novus, NB500-170), total FAK (Santa Cruz, sc-558), and phospho-FAK (Santa Cruz, sc-11765) overnight at 4°C and then with horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG) (BD PharMingen, San Diego, CA, USA, 554021) and goat anti-mouse IgG (BD PharMingen, 554002) secondary antibodies for 60 min at RT. Antibody-bound proteins were detected using enhanced chemiluminescence (ECL) reagents.

Real-Time PCR

Total RNA from skin cells was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. The first-strand cDNA was synthesized with 1 to 2 μg of total RNA using SuperScript II (Invitrogen), and one-tenth of the cDNA was used for each PCR mixture containing Express SYBR-Green qPCR Supermix (BioPrince, Seoul, South Korea). Real-time PCR was performed using a Rotor-Gene Q (QIAGEN). The reaction was subjected to amplification cycles of 95°C for 20 s, 60°C for 20 s, and 72°C for 25 s. The relative mRNA expression of the selected genes was normalized to that of peptidylprolyl isomerase A (PPIA) and quantified using the ΔΔCT method. The sequences of the PCR primers are listed in Table 1.

Table 1.

Primer Sequences for qRT-PCR

Gene	GenBank No.	Direction	Primer Sequence (5′–3′)
Human Fibronectin	NM_212482	F	GAGAATGGACCTGCAAGCCCA
		R	GTGCAAGTGATGCGTCCGC
Human Snail1	NM_005985	F	CTGGGTGCCCTCAAGATGCA
		R	CCGGACATGGCCTTGTAGCA
Human Snail2	NM_003068	F	TACCGCTGCTCCATTCCACG
		R	CATGGGGGTCTGAAAGCTTGG
Human Twist	NM_000474	F	CCTGCGCAAGATCATCCCCA
		R	GCTGCAGCTTGCCATCTTGGA
Human Vimentin	NM_003380	F	ACCCGCACCAACGAGAAGGT
		R	ATTCTGCTGCTCCAGGAAGCG

F, forward; R, reverse.

GeneMANIA Algorithm-Based Bioinformatics Analysis

To further analyze genes that interact with or directly regulate PI3K/Akt or FAK/ERK1/2 signaling, we imported all identified genes and their corresponding accession numbers into GeneMANIA (http://genemania.org). To find gene interactions, we considered several factors including co-expression, co-localization, and genetic interactions. From this list, we selected the genes’ EGF, bFGF, and HGF to test their involvement in regulating stem cell secretome-induced PI3K/Akt or FAK/ERK1/2 signaling.

Growth Factor Antibody Array

The assay was performed following the manufacturer’s protocol (Abnova AA0089). In brief, stem cell secretome or mock secretome was incubated with antibody membranes overnight at 4°C. After washing three times with wash buffer, the membranes were incubated with biotin-conjugated anti-cytokine antibodies overnight at 4°C. The membranes were then washed three times and incubated with HRP-conjugated streptavidin. Chemiluminescence was used to detect signals of the growth factors spotted on the nitrocellulose membrane.

Statistical Analysis

All the statistical data were analyzed in GraphPad Prism 5.0 (GraphPad Software, San Diego, CA) and evaluated using two-tailed Student’s t tests. Values of p < 0.05 were considered to indicate statistical significance.

Author Contributions

S.-R.P., J.-W.K., H.-S.J., and J.Y.R. conducted the experiments; I.-S.H. and H.-Y.L. designed the experiments and wrote the paper.

Conflicts of Interest

The authors have no conflicts of interest.