Table 1. Primers.
| Primer name | Sequence |
|---|---|
| Orp1-Fw | ccccccatatggtgagcaagggcgagga |
| Orp1-Rv | ggggggaattcttattccacctctttcaa |
| Grx-Fw | ccccccatatggctcaagagtttgtgaac |
| Grx-Rv | ggggggaattcttacttgtacagctcgtc |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.