Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2018 Mar 8;8:46952. doi: 10.1038/srep46952

Corrigendum: Angelman syndrome-derived neurons display late onset of paternal UBE3A silencing

Jana Stanurova, Anika Neureiter, Michaela Hiber, Hannah de Oliveira Kessler, Kristin Stolp, Roman Goetzke, Diana Klein, Agnes Bankfalvi, Hannes Klump, Laura Steenpass
PMCID: PMC5842440  PMID: 29516994

Scientific Reports 6: Article number: 30792 10.1038/srep30792; published online: August 03 2016; updated: March 08 2018

This Article contains typographical errors. In the Results section,

“We reprogrammed primary dermal fibroblasts isolated from a female patient with AS harboring a three-base pair deletion in exon 4 of the UBE3A gene (accession NM_130838)11, and from a normal healthy control person.”

should read:

“We reprogrammed primary dermal fibroblasts isolated from a female patient with AS harboring a three-base pair deletion in exon 5 of the UBE3A gene (accession NM_130838)11, and from a normal healthy control person.”

In Table S8 of the Supplementary Information file, the sequence of the forward primer ‘SNHG14_RT17_F’ for ‘qRT-PCR neuronal differentiation’,

“cttgagtattccggaagtaaaagc”

should read:

“ctcttcttgcagtttacaacgg”


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES