Scientific Reports 6: Article number: 30792 10.1038/srep30792; published online: August 03 2016; updated: March 08 2018
This Article contains typographical errors. In the Results section,
“We reprogrammed primary dermal fibroblasts isolated from a female patient with AS harboring a three-base pair deletion in exon 4 of the UBE3A gene (accession NM_130838)11, and from a normal healthy control person.”
should read:
“We reprogrammed primary dermal fibroblasts isolated from a female patient with AS harboring a three-base pair deletion in exon 5 of the UBE3A gene (accession NM_130838)11, and from a normal healthy control person.”
In Table S8 of the Supplementary Information file, the sequence of the forward primer ‘SNHG14_RT17_F’ for ‘qRT-PCR neuronal differentiation’,
“cttgagtattccggaagtaaaagc”
should read:
“ctcttcttgcagtttacaacgg”