Table 1.
List of Primers.
| Primer | Sequence (5’-3’) | Location | Purpose |
|---|---|---|---|
| FAdV4R-EndPacI-F | agtcTTAATTAAcatcatcttatataaccgcgtcttttgacac | 1–31 | Generate a 4.2-kb fragment (left end genomic region) with PacI and SpeI restriction sites |
| FAdV4R-EndSpeI–R | agtcACTAGTcttacctcggatgaactatgccactg | 4205–4230 | |
| FAdV4L-EndSpeI-F | cacaaggtacatgaatcACTAGTaatggtc | 41,844–41,873 | Generate a 3.8-kb fragment (right end genomic region) with PacI and SpeI restriction sites |
| FAdV4L-EndPacI-R | agtcTTAATTAAcatcatcttatataAccgcgtcttttgacacacttac | 45,631–45,667 | |
| FAdV-4ORF17CAT-F | catgacacagagggaggagactgcgagtaatcacctttaattattaacagctATTTAAATgtgtaggctggagctgcttc | 40,629–40,680 | Introduce CAT-gene expression cassette with upstream and downstream homologous arms to ORFs17 and 16, respectively |
| FAdV-4ORF16CAT-R | gagcaggaaaatctgcagagcactcttttggcggtcccgtgtgcggtgggtaATTTAAATcatatgaatatcctccttagttc | 41,557–41,608 | |
| FAdV-4Ver-F | cgactcctcctctttgtgggc | 40,085–40,105 | Verification |
| FAdV-4Ver-R | gcggcatctcctagaatgagg | 42,518–42,538 | Verification |
| EGFPcaSwaI-F | agctgcATTTAAATgtattaccgccatgcattag | 4717–3 | EGFP cassette amplification |
| EGFPcaSwaI-R | agctgcATTTAAATccacaactagaatgcagtg | 1597–1615 |
Restriction enzyme sites are capitalized; Sequences in bold are CAT gene cassette specific; Underlined sequences are pN1-EGFP specific. The location is based on pEGFP-N1; Primer location is based on the complete nucleotide sequence of fowl adenovirus 4 ON1 (FAdV-4ON1). Accession GU188428; Italicized sequences are extra nucleotides for restriction enzyme digestion.