Table 2.

Entamoeba Species and Prevotella copri Probes, Primers, and Cycling Conditions

Oligonucleotide (Dye)	Probe/Primer Sequencea	Cycling Conditions
E. histolytica probe (FAM)	TCATT+GAATGAATTGGCCATTTb	95°C for 3 min, then 40 cycles at 95°C for 10 s and 61°C for 20 s
E. bangladeshi probe (Texas Red)	CCTTACAGAG+TATGGCCAATTTb	95°C for 3 min, then 40 cycles at 95°C for 10 s and 61°C for 20 s
E. dispar probe (HEX)	ACTTA+CATAAATTGGCCAACTTTb	95°C for 3 min, then 40 cycles at 95°C for 10 s and 61°C for 20 s
E. moshkovskii probe (Quasar 670)	CCGTGAAGAGAGTGGCCGAb	95°C for 3 min, then 40 cycles at 95°C for 10 s and 61°C for 20 s
Entamoeba genus probe (Quasar 705)	GGATAGCTT[I-X]TGTGAATGATAAAGATAATACTT GAGACGATCCc	95°C for 3 min, then 40 cycles at 95°C for 10 s and 61°C for 20 s
Ehd-88R	GCGGACGGCTCATTATAACAd	95°C for 3 min, then 40 cycles at 95°C for 10 s and 61°C for 20 s
EM-RT-F2	GTCCTCGATACTACCAACe	95°C for 3 min, then 40 cycles at 95°C for 10 s and 61°C for 20 s
P. copri probe (FAM)	TGCCCACCACT+TGG	95°C for 3 min, then 40 cycles at 95°C for 10 s and 60°C for 1 min
P. copri F	AAGCTTGCTTTTGATGGGCG	95°C for 3 min, then 40 cycles at 95°C for 10 s and 60°C for 1 min
P. copri R	TGATCGT+CGCCTTGG	95°C for 3 min, then 40 cycles at 95°C for 10 s and 60°C for 1 min

^aEach “+” indicates the location of a “locked” nucleotide [43], and “[I-X]” indicates the location of the internal quencher.

^bProbe from Arju and Gilchrist (unpublished data).

^cProbe specific to this study.

^dPrimer Ehd-88R from Verweij et al [44].

^ePrimer EM-RT-F2 from Lau et al [22].