Table-I.
Sequence of primers for GLO I and GAPDH.
| Glyoxalase I | |
|---|---|
| Forward primer (5´3´) | GGTGACTCCTCCCCTTG |
| Reverse primer (5´3´) | ACTCGTAGCATGGTCTGCTG |
| GAPDH | |
| Forward primer (5´3´) | GCTCTCTGCTCCTCCTGTTC |
| Reverse primer (5´3´) | TTCCCGTTCTCAGCCTTGAC |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.