Key resources table.
| Reagent type (species) or resources |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, A2:A128 strain background (Mus musculus, C57BL/6J) |
Sirt2 knockout mice, JAX Stock #012772 - B6.129-Sirt2 < tm1.1Fwa>/J |
Jackson Laboratories, USA | ||
| Strain, strain background (Mus musculus, 129/SvJ) |
WT, JAX stock # 000691 | Jackson Laboratories, USA | ||
| Cell line (human) | HeLa | ATCC | ||
| Cell line (human) | HEK 293 | ATCC | ||
| Cell line (mouse) | GSK3β-KO fibroblasts | James Woodgett, Mount Sinai Hospital, Toronto, Canada | ||
| Strain, (Wistar rats) | WT | Central Animal Facility, Indian Institute of Science, India | P1-P2 pups used for primary cardiomyocytes culture | |
| Antibody | anti-GSK3β | Cell Signaling Technology | 9315 | 1:1000 diluted in 5% BSA |
| Antibody | anti-GSK3β | Santa Cruz Biotechnology | sc-9166 | 1:1000 diluted in 5% milk for Western blotting 1:200 diluted in 1% BSA for immuno-fluorescence |
| Antibody | anti-Acetylated-Lysine | Cell Signaling Technology | 9681 | 1:1000 diluted in 5% BSA |
| Antibody | anti-Acetylated-Lysine | Cell Signaling Technology | 9441 | 1:1000 diluted in 5% BSA |
| Antibody | anti-GSK3β Ser-9 | Cell Signaling Technology | 9336 | 1:1000 diluted in 5% BSA |
| Antibody | anti-GSK3β Tyr 279/216 | Merck Millipore | 05–413 | 1:250 diluted in 5% BSA |
| Antibody | anti-Phospho-β-Catenin | Cell Signaling Technology | 9561 | 1:2000 diluted in 5% BSA |
| Antibody | anti-β-Catenin | Cell Signaling Technology | 8480 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT2 | Sigma-Aldrich | S8447 | 1:2000 diluted in 5% BSA |
| Antibody | anti-SIRT2 | Merck Millipore | 09–843 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT2 | Cell Signaling Technology | 12650 | 1:1000 diluted in 5% BSA |
| Antibody | anti-ANP | Abcam | 14348 | 1:250 diluted in 5% BSA |
| Antibody | anti-ANP | Cloud-Clone Corporation | PAA225Ra03 | 1:200 diluted in 1% BSA |
| Antibody | anti-GAPDH | Santa Cruz Biotechnology | sc-25778 | 1:1000 diluted in 5% milk |
| Antibody | anti-p300 | Merck Millipore | 05–257 | 1:1000 diluted in 5% BSA for Western blotting, 1:200 diluted in 1% BSA for immuno-fluorescence |
| Antibody | anti-phospho-Glycogen Synthase | Merck Millipore | 07–817 | 1:1000 diluted in 5% BSA |
| Antibody | anti-Glycogen Synthase | Cell Signaling Technology | 3893 | 1:1000 diluted in 5% BSA |
| Antibody | anti-β -actin (HRP-conjugate) | Cell Signaling Technology | 12262 | 1:3000 diluted in 5% BSA |
| Antibody | anti-β -actin (HRP-conjugate) | Sigma-Aldrich | A3854 | 1:3000 diluted in 5% BSA |
| Antibody | anti-GSK3 α/β | Merck Millipore | 04–903 | 1:1000 diluted in 5% BSA |
| Antibody | anti-puromycin | Developmental Studies Hybridoma Bank | PMY-2A4 | 1:500 diluted in 5% BSA |
| Antibody | anti-NFATc2 | Thermo Fisher Scientific | MA1-025 | 1:100 diluted in 5% BSA |
| Antibody | anti-Flag | Sigma-Aldrich | F2555 | 1:2000 diluted in 5% BSA |
| Antibody | anti-α-Tubulin | Cell Signaling Technology | 2144 | 1:2000 diluted in 5% BSA |
| Antibody | anti-Acetyl-α-Tubulin (Lys40) | Cell Signaling Technology | 5335 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT1 | Santa Cruz Biotechnology | sc-15404 | 1:1000 diluted in 5% milk |
| Antibody | anti-SIRT3 | Cell Signaling Technology | 5490 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT4 | Cloud-Clone Corporation | PAE914Hu01 | 1:500 diluted in 5% BSA |
| Antibody | anti-SIRT5 | Cloud-Clone Corporation | PAE915Mu01 | 1:500 diluted in 5% BSA |
| Antibody | anti-SIRT6 | Cell Signaling Technology | 12486 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT7 | Cloud-Clone Corporation | PAE917Hu01 | 1:500 diluted in 5% BSA |
| Antibody | anti-HA | Sigma-Aldrich | H9658 | 1:2000 diluted in 5% BSA |
| Antibody | anti-HA | Santa Cruz Biotechnology | sc-805 | 1:100 diluted in 1% BSA for immuno-fluorescence |
| Antibody | anti-p300 | Merck Millipore | 05–257 | 1:1000 diluted in 5% BSA for Western, 1:100 diluted in1% BSA for immuno-fluorescence |
| Antibody | anti-SOD2 | Santa Cruz Biotechnology | sc-515068 | 1:200 diluted in 5% milk |
| Antibody | anti-α -Actinin | Sigma-Aldrich | A5044 | 1:200 diluted in 5% BSA |
| Antibody | Clean-Blot IP Detection Reagent | Thermo Fisher Scientific | 21230 | 1:2000–5000 diluted in 5% milk |
| Antibody | anti-rabbit HRP | Santa Cruz Biotechnology | sc-2004 | 1:5000 diluted in 1% milk |
| Antibody | anti-mouse HRP | Santa Cruz Biotechnology | sc-2005 | 1:5000 diluted in 1% milk |
| Antibody | anti-mouse HRP | Thermo Fisher Scientific | 31430 | 1:5000 diluted in 1% milk |
| Antibody | anti-rabbit HRP | Thermo Fisher Scientific | 31460 | 1:5000 diluted in 1% milk |
| Antibody | anti-rabbit IgG light chain HRP | Abcam | ab99697 | 1:5000 diluted in 1% milk |
| Antibody | Donkey anti-mouse, Alexa Fluor 488 | Thermo Fisher Scientific | A-21202 | 1:200 diluted in 5% BSA |
| Antibody | Goat anti-rabbit, Alexa Fluor 546 | Thermo Fisher Scientific | A-11035 | 1:200 diluted in 5% BSA |
| Antibody | Ni-NTA Agarose | Qiagen | 30230 | |
| Antibody | ANTI-FLAG M2 Affinity Agarose Gel | Sigma-Aldrich | A2220 | |
| Antibody | Glutathione Sepharose 4B | GE healthcare | 17-0756-01 | |
| Antibody | Monoclonal Anti-HA−Agarose antibody produced in mouse | Sigma-Aldrich | A2095 | |
| Antibody | Protein A/G Agarose | Santa Cruz Biotechnology | sc-2003 | |
| Transfected construct | pcDNA3 Flag HA | Addgene | Plasmid 10792 | 1436 pcDNA3 Flag HA plasmid DNA was a gift from William Sellers |
| Transfected construct (human) | HA GSK3 beta wt pcDNA3 | Addgene | Plasmid 14753 | PMID: 7715701 |
| Transfected construct (human) | HA GSK3 alpha wt | Modified Addgene, plasmid15896 | This paper | |
| Transfected construct (human) | HA GSK3 beta S9A pcDNA3 | Addgene | Plasmid 14754 | PMID: 7980435 |
| Transfected construct (human) | HA GSK3 beta K85A pcDNA3 | Addgene | Plasmid 14755 | HA GSK3 beta K85A pcDNA3 was a gift from Jim Woodgett |
| Transfected construct (human) | HA GSK3 beta K150Q pcDNA3 | Modified Addgene, plasmid14753 | This paper | For, caccggcagggtctgctgcgcgcggctataatg; Rev, cattatagccgcgcgcagcagaccctgccggtg; |
| Transfected construct (human) | HA GSK3 beta K150R pcDNA3 | Modified Addgene, plasmid 14754 | This paper | For, attatagccgcgcgagacagaccctgccg; Rev, cggcagggtctgtctcgcgcggctataat; |
| Transfected construct (human) | HA GSK3 beta K183Q pcDNA3 | Modified Addgene, plasmid 14755 | This paper | For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc; |
| Transfected construct (human) | HA GSK3 beta K183R pcDNA3 | Modified Addgene, plasmid14756 | This paper | For, aggttctgcggtctaatatcgcgatggcaaatgcca; Rev, tggcatttgccatcgcgatattagaccgcagaacct. |
| Transfected construct (human) | GST-GSK3β | This paper | ||
| Transfected construct (human) | HIS- GSK3β | This paper | ||
| Transfected construct (human) | HIS- GSK3β-K183R | This paper | ||
| Transfected construct (human) | HIS- GSK3β-K183Q | This paper | ||
| Transfected construct (human) | SIRT1 Flag | Addgene | Plasmid 13812 | PMID: 12620231 |
| Transfected construct (human) | SIRT2 Flag | Addgene | Plasmid 13813 | PMID: 12620231 |
| Transfected construct (human) | SIRT3 Flag | Addgene | Plasmid 13814 | PMID: 12620231 |
| Transfected construct (human) | SIRT4 Flag | Addgene | Plasmid 13815 | PMID: 12620231 |
| Transfected construct (human) | SIRT5 Flag | Addgene | Plasmid 13816 | PMID: 12620231 |
| Transfected construct (human) | SIRT6 Flag | Addgene | Plasmid 13817 | PMID: 12620231 |
| Transfected construct (human) | SIRT7 Flag | Addgene | Plasmid 13818 | PMID: 12620231 |
| Transfected construct (human) | SIRT2-H187Y Flag | Modified from Addgene, plasmid 13818 | For 5'atgtgtagaaggtgccatacgcctccaccaagtcc3'- Rev 5'ggacttggtggaggcgtatggcaccttctacacat3'. | |
| Infected construct (human) | Ad-Null | Vector Biolabs | Adenovirus 1300 | |
| Infected construct (human) | Ad-GFP | Vector Biolabs | Adenovirus 1060 | |
| Infected construct (human) | Ad-SIRT2 | Vector Biolabs | Adenovirus 1519 | |
| Infected construct (human) | Ad-h-EP300 | Vector Biolabs | Adenovirus ADV-207954 | |
| Infected construct (human) | Ad-luc-shRNA | B. Thimmapaya, Northwestern University, Chicago, IL, USA | PMID: 26667039 | |
| Infected construct (human) | Ad-h-EP300-shRNA | B. Thimmapaya, Northwestern University, Chicago, IL, USA | PMID: 26667039 | |
| Recombinant protein | p300 | Merck Millipore | 14–418 | http://dx.doi.org/10.1038/s41418-018-0069-8 |
| Sequence-based reagent | SMART pool: siGENOME Non-Targeting siRNA 1 | Dharmacon | D-001206-13-50 | 100 nM siRNA transfected by Lipofectamine RNAiMAX Transfection Reagent |
| Sequence-based reagent | SMART pool: siGENOME Rat Sirt2 siRNA | Dharmacon | M-082072-01-0010 | 100 nM SMARTpool siRNA transfected by Lipofectamine RNAiMAX Transfection Reagent |
| Commercial assay or kit | GSK-3 Activity Assay Kit | Sigma-Aldrich | CS0990 | PMID: 26667039 |
| Commercial assay or kit | QuikChange Site-Directed Mutagenesis Kit | Agilent Technologies | 200518 | PMID: 26667039 Sequences verified by sequencing, SciGenom Labs |
| Commercial assay or kit | GenElute HP Plasmid Midiprep Kit | Sigma-Aldrich | NA0200 | |
| Commercial assay or kit | GEnElute HP Plasmid Miniprep Kit | Sigma-Aldrich | PLN70 | |
| Commercial assay or kit | Qubit dsDNA HS assay kit | Thermo Fisher Scientific | Q32851 | PMID: 25871545 |
| Chemical compound, drug | Lipofectamine 2000 Transfection Reagent | Thermo Fisher Scientific | 11668019 | |
| Chemical compound, drug | Lipofectamine RNAiMAX Transfection Reagent | Thermo Fisher Scientific | 13778150 | |
| Chemical compound, drug |
Horse serum, heat inactivated | Thermo Fisher Scientific | 26050088 | |
| Chemical compound, drug | Fetal Bovine Serum | Thermo Fisher Scientific | 10500064 | |
| Chemical compound, drug | Penicillin-Streptomycin | Thermo Fisher Scientific | 15070063 | |
| Chemical compound, drug | Gelatin, Type B | Sigma-Aldrich | G9382 | 0.2% w/v |
| Chemical compound, drug | D-glucose | Sigma-Aldrich | G8270 | 0.01 M prepared in PBS |
| Chemical compound, drug | Collagenase, Type II | Thermo Fisher Scientific | 17101015 | 0.4 mg/ml prepared in Trypsin-PBS-Glucose |
| Chemical compound, drug | Trypsin | Thermo Fisher Scientific | 15050057 | 0.2% prepared in PBS-Glucose |
| Chemical compound, drug | Trypsin-EDTA | Thermo Fisher Scientific | 25200056 | 0.1% prepared in PBS |
| Chemical compound, drug | Isoproterenol | Sigma-Aldrich | I6504 | https://doi.org/10.1172/JCI39162 |
| Chemical compound, drug | AGK2 | Cayman Chemical | 13145 | http://dx.doi.org/10.1038/s41418-018-0069-8 |
| Chemical compound, drug | Lithium chloride | Sigma-Aldrich | 203637 | PMID: 20926980 |
| Chemical compound, drug | GSK-3 Inhibitor X | Calbiochem | CAS 740841-15-0 - | PMID: 16984885 |
| Chemical compound, drug | Anacardic Acid | Cayman Chemical | CAS16611840 | PMID: 28513807 |
| Chemical compound, drug | Puromycin | VWR | J593 | |
| Chemical compound, drug | Fluoromount-G | Southern Biotech | 0100–01 | |
| Chemical compound, drug | Hoechst 33342 | Thermo Fisher Scientific | H3570 | |
| Chemical compound, drug | Dulbecco's Modified Eagle's Medium- High glucose | Sigma-Aldrich | D5648 | |
| Chemical compound, drug | Isoflurane | Sosrane Neon Laboratories Ltd | ||
| Chemical compound, drug | Nicotinamide | Sigma-Aldrich | N3376 | |
| Chemical compound, drug | Trichostatin A | Sigma-Aldrich | T8552 | |
| Chemical compound, drug | ProLong Gold Antifade Mounting medium with DAPI | Thermo Fisher Scientific | P36931 | |
| Chemical compound, drug | Acrylamide | Sigma-Aldrich | A9099 | |
| Chemical compound, drug | Tris | Sigma-Aldrich | T6066 | |
| Chemical compound, drug | Hydrochloric acid | Fischer Scientific | 29505 | |
| Chemical compound, drug | Sodium-dodecyl sulphate | VWR | 0227 | |
| Chemical compound, drug | Ammonium persulphate | Sigma-Aldrich | A3678 | |
| Chemical compound, drug | TEMED | Sigma-Aldrich | T7024 | |
| Chemical compound, drug | Sodium chloride | Merck Millipore | 106404 | |
| Chemical compound, drug | Triton X-100 | Sigma-Aldrich | T8787 | |
| Chemical compound, drug | EDTA | Sigma-Aldrich | E5134 | |
| Chemical compound, drug | EGTA | Sigma-Aldrich | 324626 | |
| Chemical compound, drug | sodium pyrophosphate | Sigma-Aldrich | 221368 | |
| Chemical compound, drug | sodium orthovanadate | Sigma-Aldrich | 450243 | |
| Chemical compound, drug | Tween-20 | Sigma-Aldrich | P9416 | |
| Chemical compound, drug | cOmplete, Mini Protease Inhibitor Cocktail | Sigma-Aldrich | 11836153001 ROCHE | |
| Chemical compound, drug | PMSF | Sigma-Aldrich | P7626 | |
| Chemical compound, drug | 2X Laemmli Sample Buffer | Bio-Rad | 161–0737 | |
| Chemical compound, drug | β-mercaptoethanol | VWR | 0482 | |
| Chemical compound, drug | DMSO | Sigma-Aldrich | D8418 | |
| Chemical compound, drug | Clarity ECL Western Blotting Substrate | BioRad | 5060 | |
| Chemical compound, drug | SuperSignal West Pico chemiluminescent Substrate | Thermo Fisher Scientific | 34080 | |
| Chemical compound, drug | IPTG | Sigma-Aldrich | I6758 | |
| Chemical compound, drug | Glycerol | PUREGENE | PG-4580 | |
| Chemical compound, drug | Sodium hydroxide | Sigma-Aldrich | 221465 | |
| Chemical compound, drug | Calcium chloride | Sisco Research Laboratories | 70650 | |
| Chemical compound, drug | formaldehyde solution | Sigma-Aldrich | F1635 | |
| Chemical compound, drug | Bovine serum albumin | HIMEDIA | MB083 | |
| Chemical compound, drug | Glycine | Fischer Scientific | 12835 | |
| Chemical compound, drug | Non-fat-milk | HIMEDIA | GRM1254 | |
| Chemical compound, drug | Methanol | Honeywell | 230–4 | |
| Chemical compound, drug | Bis-acrylamide | Sigma-Aldrich | M7279 | |
| Chemical compound, drug | Sodium deoxycholate | Sigma-Aldrich | D6750 | |
| Chemical compound, drug | Sodium bicarbonate | Sigma-Aldrich | S6014 | |
| Chemical compound, drug | Bio-Rad Protein Assay Dye Reagent Concentrate | Bio-Rad | 5000006 | |
| Chemical compound, drug | Ampicillin | VWR | 0339 | |
| Chemical compound, drug | Leucine-free minimal essential medium | Thermo fisher Scientific | 30030 | |
| Chemical compound, drug | DTT | Sigma-Aldrich | DTT-RO | |
| Chemical compound, drug | Sodium butyrate | Sigma-Aldrich | 567430 | |
| Chemical compound, drug | Magnesium chloride | Sigma-Aldrich | M8266 | |
| Chemical compound, drug | Sodium fluoride | Sigma-Aldrich | 450022 | |
| Chemical compound, drug | Glutathione-reduced | Sigma-Aldrich | G4251 | |
| Chemical compound, drug | Bromophenol blue | Sigma-Aldrich | B8026 | |
| Chemical compound, drug | HEPES | Sigma Aldrich | H3784 | |
| Chemical compound, drug | ATP | Cell Signaling Technology | 9804 | |
| Chemical compound, drug | γ−32P-ATP | Bhabha Atomic Research Centre, India | ||
| Chemical compound, drug | [3H]leucine | Amersham Biosciences | TRK510 | |
| Chemical compound, drug | NAD+ | Sigma Aldrich | NAD100-RO-Roche | |
| Equipment | VisualSonics high-frequency ultrasound system | Vevo 1100 | ||
| Equipment | SDS-PAGE Gel running apparatus | Bio-Rad | ||
| Equipment | Western blotting apparatus | Bio-Rad | ||
| Equipment | Scintillation counter | Beckman | ||
| Equipment | Chemiluminescence imager | Chemidoc Touch, Biorad, USA |
||
| Equipment | ThermoMixer C | Eppendorf | ||
| Equipment | Power-pack | Bio-Rad | ||
| Equipment | LSM 880 confocal microscope | Zeiss | ||
| Equipment | Tissue-culture ware | Eppendorf | ||
| Software, algorithm | GraphPad Prism 5 | GraphPad Software | ||
| Software, algorithm | QuickChange Primer Design | Agilent Genomics | ||
| Software, algorithm | ImageJ | National Institutes of Health | ||
| Software, algorithm | ZEN 5 | Zeiss | ||
| Software, algorithm | Image Lab | Bio-Rad | ||
| Software, algorithm | Mascot data explorer software | Matrix Science, London, United Kingdom | ||
| Software, algorithm | Scaffold_2.1.03 | Proteome Software, Inc., Portland, OR | ||
| Software, algorithm | Swiss-model tool | ExPASy web server | PMID:24782522 | |
| Software, algorithm | UCSF Chimera software package | Resource for Biocomputing, Visualization, and Informatics, NHI | PMID:15264254 | |
| Software, algorithm | GROMACS simulation package, version 5.0.4 | |||
| Software, algorithm | PyTMs plugin of PyMOL | https://doi.org/10.1186/s12859-014-0370-6 | ||
| Miscellaneous | Osmotic Minipumps | ALZET | Models 2002, 2001 | PMID: 19652361 |
| Miscellaneous | Cover-slip 18 mm | Blue Star Slides | ||
| Miscellaneous | PVDF membrane Amersham Hybond P |
GE Healthcare | 10600023 | |
| Miscellaneous | Nitrocellulose paper | Biorad | ||
| Miscellaneous | Cell culture wares | Eppendorf | ||
| Miscellaneous | Sigma cell scraper | Sigma-Aldrich | SIAL0010 |