REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
anti-CD3 | Abcam | Cat# ab8090 |
anti-CD28 | BD Biosciences | Cat# 555725 |
GREB1 | Abcam | Cat# ab72999 |
GLUL | BD Biosciences | Cat# 610517 |
HSP70 | Cell Signaling | Cat# 4872 |
α-tubulin | Sigma | Cat# T6793 |
IRDye800 (anti-mouse) | Li-Cor | Cat# 925-32210 |
IRDye680 (anti-rabbit) | Li-Cor | Cat# 925-68071 |
Biological Samples | ||
Human buffy coats (consented donors, IRB approved) | DRK-Blutspendedienst Mannheim | N/A |
Chemicals, Peptides, and Recombinant Proteins | ||
17-AAG | LC LABS | Cat# A-6880 |
I-BET151 | GSK compound collection (Dawson et.al. 2011) | CAS: 1300031-49-5 |
estradiol | Sigma-Aldrich | Cat# E8875; E2758 |
GW7604 | GSK compound collection | CAS: 195611-82-6 |
raloxifene | GSK compound collection | CAS: 84449-90-1 |
JQ1 | Carbosynth | Cat# FC43273 |
calyculin A | Apollo Scientific | Cat# BIC1019 |
sodium orthovanadate | Sigma-Aldrich | Cat# S6508 |
JQ1-VHL PROTAC | This publication | N/A |
JQ1-Az | This publication | N/A |
VHL alkyne | This publication | N/A |
IBET-151-PROTAC | This publication | N/A |
TMT10plex | ThermoFisherScientific | Cat# 90406 |
Basal RPMI medium | GIBCO | Cat# A24942-01 |
Dialysed FBS | GIBCO | Cat# 26400-044 |
Glucose 2g/L | GIBCO | Cat# A24940-01 |
L-Glutamine (200 mM) | GIBCO | Cat# 24030-032 |
L-Arginine light | Sigma | Cat# A8094-25G |
L-Lysine light | Sigma | Cat# L9037-25G |
L-Arginine heavy (SILAC) | Thermo | Cat# 88434 |
L-Lysine heavy (SILAC) | Sigma | Cat# 608041-1G |
Cy3-Oligo(dT)50 | Sigma | N/A |
Wheat Germ Agglutinin (WGA) Alexa Fluor 647 Conjugate | Life Technologies | Cat# W32466 |
Hoechst 33258 | Sigma | Cat# H3569 |
Recombinant FYTTD1 | Abcam | Cat# ab164533 |
Protein G beads | Sigma | Cat# P7700 |
benzonase | Sigma | Cat# E1014 |
Igepal CA-630 | Sigma | Cat# I8896 |
Critical Commercial Assays | ||
T cells negative selection kit | StemCell Technologies | Cat# 19051 |
CellTiter-Glo | Promega | Cat# G9242 |
RNAquous extraction kit | Life Technologies | Cat# Q10212 |
Maxima First Strand cDNA kit | Thermo Fisher | Cat# K1641 |
Qubit kit | Life Technologies | Cat# Q10212 |
TaqMan master mix | Thermo Fisher | Cat# 4369016 |
Deposited Data | ||
Supplemental datasets for individual Figures | Mendeley Data | https://doi.org/10.17632/8pzhg2tdyb.1 |
Multiplexed proteome dynamics profiling of JQ1-PROTAC | PRIDE | PXD008637 |
Thermal proteome profiling of JQ1 | PRIDE | PXD008638 |
2 Dimensional Thermal proteome profiling of JQ1 | PRIDE | PXD008626 |
Multiplexed proteome dynamics profiling of Estradiol and SERMs | PRIDE | PXD008636 |
Expression proteomics combination treatment of Estradiol and SERMs | PRIDE | PXD008628 |
Multiplexed proteome dynamics profiling of HSP90 inhibitor 17-AAG | PRIDE | PXD008633 |
Immunoaffinity enrichment of GREB1 to co-enrich HSP90 | PRIDE | PXD008631 |
Thermal proteome profiling of Jurkat cells | PRIDE | PXD008639 |
Kinobeads affinity enrichment from lysate derived from stimulated cells | PRIDE | PXD008632 |
Jurkat protein half live | PRIDE | PXD008629 |
T cell protein half live | PRIDE | PXD008630 |
Multiplexed proteome dynamics profiling of HSP90 inhibitor 17-AAG in T cells | PRIDE | PXD008635 |
Multiplexed proteome dynamics profiling of HSP90 inhibitor 17-AAG in anti-CD3 and anti-CD28 stimulated T cells | PRIDE | PXD008634 |
Expression profiling of HSP90 inhibitor 17-AAG in anti-CD3 and anti-CD28 stimulated T cells | PRIDE | PXD008627 |
Experimental Models: Cell Lines | ||
THP-1 | ATCC | TIB-202 |
MCF-7 | ATCC | HTB-22 |
Jurkat | ATCC | TIB-152 |
Oligonucleotides | ||
Amplicon context sequence for GLUL (FAM) | Thermo Fisher | Cat# 4331182 |
ACCCGGACCCTGGACA GTGAGCCCAAGTGT GTGGAAGAGT |
Assay ID# Hs00365928 | |
Amplicon context sequence for RPL7 (VIC) | Thermo Fisher | Cat# 4331182 |
AGAACCCAAATTGGC GTTTGTCATCAGAATCAGAGGTA |
Assay ID# Hs02596927 | |
Software and Algorithms | ||
ImageJ 1.45 s | NIH | https://imagej.nih.gov/ij/download.html |
CellProfiler 2.1.1 | Broad Institute | http://cellprofiler.org |
Mascot 2.4 | Matrix Science, Boston, MA | N/A |
isobarQuant | Franken et al., 2015 | https://github.com/protcode/isob/archive/1.1.0.zip |
R 3.4.1 | R Core Team | https://www.R-project.org |
TPP library | Franken et al., 2015 | http://bioconductor.org/biocLite.R; library(“TPP”) |
Spotfire 7.0.1.24 | Tibco | https://spotfire.tibco.com |
Graphpad Prism 7 | GraphPad Software | https://www.graphpad.com |