REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-human DBR1 antibody	ProteinTech	Cat# 16019-1-AP
Rabbit polyclonal anti-human DBR1 antibody	Santa-Cruz, Custom-produced	N/A
Mouse monoclonal anti-human GAPDH antibody	Santa-Cruz	Cat# sc-365062
Mouse monoclonal anti-FLAG antibody	SIGMA	Cat# F1804
Goat anti-human polyclonal anti-IFN-λ1 antibody	R&D	Cat# AF1598
Human IFN-λ1 biotinylated antibody	R&D	Cat# BAF1598
Bacterial and Virus Strains
HSV1 (KOS strain)	ATCC	Cat# VR1493
HSV1-GFP (based on KOS strain)	Dr Desai laboratory, Desai et al., 1998	N/A
VSV (Indiana strain)	This laboratory	N/A
Escherichia coli (strain BL21)	Life Technologies	Cat# C600003
Biological Samples
Human Heart Protein Medley	ClonTech	Cat# 635302
Human Smooth Muscle Protein Medley	ClonTech	Cat# 635333
Human Stomach Protein Medley	ClonTech	Cat# 635313
Human Lymph Node Protein Medley	ClonTech	Cat# 635316
Human Spleen Protein Medley	ClonTech	Cat# 635312
Human Thymus Protein Medley	ClonTech	Cat# 635350
Human Fetal Liver Protein Medley	ClonTech	Cat# 635342
Human Kidney Protein Medley	ClonTech	Cat# 635303
Human Brain Cerebral Cortex Protein Medley	ClonTech	Cat# 635323
Human Brain Hippocampus Protein Medley	ClonTech	Cat# 635319
Human Brain Frontal Lobe Protein Medley	ClonTech	Cat# 635318
Human Brain Temporal Lobe Protein Medley	ClonTech	Cat# 635321
Human Brain Hypothalamus Protein Medley	ClonTech	Cat# 635320
Human Brain Cerebellum Protein Medley	ClonTech	Cat# 635326
Human Brain medulla oblongata Protein Medley	ClonTech	Cat# 635346
Human Brainstem Protein Medley	ClonTech	Cat# 635325
Human Spinal Cord Protein Medley	ClonTech	Cat# 635324
Human Skin Protein Medley	ClonTech	Cat# 635355
Human Brain medulla oblongata lysate	ProSci-Inc	Cat# XBL-10111
Human Spinal Cord lysate	ProSci-Inc	Cat# 1377
C57/BalbC mouse tissue lysates	This manuscript	N/A
Chemicals, Peptides, and Recombinant Proteins
Recombinant wild-type and mutant human DBR1 proteins	This manuscript	N/A
Recombinant IFN-α2b	Schering-Plough	Intron® A
Polyinosine-polycytidylic acid (Poly(I:C))	GE Healthcare	Cat# 27-4729-01
Random hexamers	Invitrogen	Cat# N8080127
Multiscribe reverse transcriptase	Applied Biosystems	Cat# 4308226
TaqMan universal PCR master mix	Applied Biosystems	Cat# 4304437
Extremgene 9 reagent	Sigma-Aldrich	Cat# XTG9-RO
Lipofectamine-3000	Life Technologies	Cat# L3000001
Critical Commercial Assays
miRNeasy Mini Kit	QIAGEN	Cat# 217004
QuantiTect SYBR Green PCR kit	QIAGEN	Cat# 204141
Complete Lysis-M EDTA-free	Sigma-Aldrich	Cat# 4719964001
RiboZero TruSeq Stranded Total RNA Library Prep Kit	Illumina	Cat# RS-122-2201
TruSeq DNA Sample Prep Kit	Illumina	Cat# FC-121-2001
Illumina HiSeq 2000	Illumina	Cat# HiSeq 2000
Illumina NextSeq 500	Illumina	Cat# NextSeq 500
Genome-wide SNP 6.0 array	Affymetrix	Cat# 901182
SuperScript III Cells-Direct kit	Life Technologies	Cat# 18080200
Cell lysis buffer (10X)	Cell Signaling Technologies	Cat# 9803
Bac-to-Bac system	Life Technologies	Cat# A11099
Resazurin oxidoreduction (TOX-8)	Sigma-Aldrich	Cat# TOX8 Sigma
IL-6 ELISA kit	R&D	Cat# DY206-05
Deposited Data
Genome Reference Consortium Human Build hg19		N/A
The Genome Aggregation Database (gnomAD)	Large scale human genome and exome sequencing database	http://gnomad.broadinstitute.org/about
The Exome Aggregation Consortium (ExAC)	Large scale human exome sequencing database	http://exac.broadinstitute.org/
1000 Genome Project	International genome sample resource	http://www.internationalgenome.org/
Raw and analyzed whole-exome sequencing and RNA-Seq data	This manuscript	SRA: SRP130621
Experimental Models: Cell Lines
DBR1 I120T/I120T human fibroblasts	This manuscript	N/A
DBR1 Y17H/Y17H human fibroblasts	This manuscript	N/A
DBR1 I120T/I120T human EBV-B cell lines	This manuscript	N/A
HEK293T cells	ATCC	Cat# CRL11268
Sf9 cells	Expression Systems	Cat# 94-006S
Dbr1-1 yeast	Dr Boeke laboratory, Chapman and Boeke, 1991	N/A
Experimental Models: Organisms/Strains
N/A
Oligonucleotides
Primer for human ID1 intron lariats RT-qPCR (forward): CCACTTCCGTCCCATCCTT	This manuscript	N/A
Primer for human ID1 intron lariats RT-qPCR (reverse, branch point): GGTCGGATCTGGATCTCACTTGG	This manuscript	N/A
Primer for human DKK1 intron lariats RT-qPCR (forward): GAGGGAGTAGAACGTGCTGA	This manuscript	N/A
Primer for human DKK1 intron lariats RT-qPCR (reverse, branch point): GCCCGACCCCTCTCACTGAG	This manuscript	N/A
Primer for human GUS mRNA RT-qPCR (forward): CACCAGGATCCACCTCTGAT	This manuscript	N/A
Primer for human GUS mRNA RT-qPCR (reverse): TCCAAATGAGCTCTCCAACC	This manuscript	N/A
Primer for HSV1 UL30 qPCR (forward): CATCACCGACCCGGAGAGGGAC	This manuscript	N/A
Primer for HSV1 UL30 qPCR (reverse): GGGCCAGGCGCTTGTTGGTGTA	This manuscript	N/A
Probe for HSV1 UL30 qPCR: 5′-6FAM-CCGCCGAACTGAGCAGACACCCGCGC-ZEN/lowa Black FQ	This manuscript	N/A
Primers for yeast Actin intron lariat Northern-Blot probe generation	Dr Boeke laboratory, Chapman and Boeke, 1991	N/A
Recombinant DNA
pTRIP-DBR1-RFP plasmids containing wild-type or mutant human DBR1 cDNA	This manuscript	N/A
pcDNA3-DBR1-FLAG plasmids containing wild-type or mutant human DBR1 cDNA	This manuscript	N/A
pET expression plasmids containing wild-type or mutant human DBR1 cDAN	This manuscript	N/A
pRS315 expression plasmids containing wild-type or mutant yeast Dbr1 cDNA	This manuscript	N/A
Software and Algorithms
Graph Pad Prism 5	GraphPad software	https://www.graphpad.com/scientific-software/prism/
GeneTools image analysis software	Syngene	http://www.syngene.com/genetools-software-download/
Genome Analysis Toolkit (GATK)	Genome variant call software	https://software.broadinstitute.org/gatk/
Affymetrix Power Tools	Genotype calling software	www.affymetrix.com/partners_programs/programs/developer/tools/powertools.affx
Merlin	Parametric multipoint linkage analysis software. Abecassis et al., 2002	http://csg.sph.umich.edu/abecasis/merlin/reference.html
Iterative inverted alignment method for branchpoint-traversing lariat reads identification	Taggart et al., 2017	http://fairbrother.biomed.brown.edu/data/Lariat2016/
STAR RNA-Seq aligner	Dobin et al., 2013	http://code.google.com/p/rna-star/
HTseq-count (v0.6.1, Ensembl v75 transcript annotations)	Anders et al., 2015	http://www-huber.embl.de/HTSeq
Gene-set enrichment testing for Hallmark (H) gene sets (Molecular Signatures Database v6.1)	Liberzon et al., 2015	http://software.broadinstitute.org/gsea/msigdb
DESeq2 package (v1.14.1)	Love et al., 2014	http://www.bioconductor.org/packages/release/bioc/html/DESeq2.html
voom/limma package (v 3.22.7)	Law et al., 2014	https://bioconductor.riken.jp/packages/3.0/bioc/html/limma.html
Other
N/A