| shRNA | Sequence | Vector |
|---|---|---|
| shCtrl | Clontech | pSiren‐retroQ |
| shDDR1.1 | gggatggactcctgtctta | pSiren‐retroQ |
| shDDR1.2 | agatggagtttgagtttgac | pSiren‐retroQ |
| shMock | gacactcggtagtctatac | pSUPER.retro.neo.GFP |
| shBCR | ggtcaacgacaaagaggtg | pSUPER.retro.neo.GFP |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.