Abstract
POLQ is a unique multifunctional replication and repair gene that encodes for a N-terminal superfamily 2 helicase and a C-terminal A-family polymerase. Although the function of the polymerase domain has been investigated, little is understood regarding the helicase domain. Multiple studies have reported that polymerase θ-helicase (Polθ-helicase) is unable to unwind DNA. However, it exhibits ATPase activity that is stimulated by single-stranded DNA, which presents a biochemical conundrum. In contrast to previous reports, we demonstrate that Polθ-helicase (residues 1–894) efficiently unwinds DNA with 3′–5′ polarity, including DNA with 3′ or 5′ overhangs, blunt-ended DNA, and replication forks. Polθ-helicase also efficiently unwinds RNA-DNA hybrids and exhibits a preference for unwinding the lagging strand at replication forks, similar to related HELQ helicase. Finally, we find that Polθ-helicase can facilitate strand displacement synthesis by Polθ-polymerase, suggesting a plausible function for the helicase domain. Taken together, these findings indicate nucleic acid unwinding as a relevant activity for Polθ in replication repair.
Keywords: DNA helicase, DNA enzyme, DNA repair, DNA polymerase, DNA damage, DNA damage response, DNA replication, alternative end-joining, double-strand break repair, microhomology-mediated end-joining, replication fork repair, helicase, polymerase
Introduction
POLQ is a unique gene in higher eukaryotes that encodes for a N-terminal superfamily 2 (SF2) helicase and a C-terminal A-family polymerase with a large central domain that lacks any known enzymatic domain (Fig. 1A) (1–3). Understanding the biochemical activities and cellular functions of Polθ has become a priority because it has been found to be essential for the error-prone double-strand break (DSB)2 repair pathway known as microhomology-mediated end-joining (MMEJ) or alternative end-joining (alt-EJ) (3–9). Remarkably, Polθ expression has also been shown to be important for the proliferation of cells deficient in the homologous recombination (HR) pathway, such as because of mutations in BRCA1 or BRCA2 (4, 10). Recent studies additionally demonstrate that Polθ is responsible for random DNA integration into the genomes of mammalian cells, and for T-DNA integration into plant genomes (11–13). In addition to these functions, Polθ was shown to be essential for DSB repair in zebrafish embryos and is involved in replication timing and potentially replication fork repair (10, 14, 15). Thus, the recent expansion of Polθ studies has revealed multiple essential and important functions for this enigmatic protein in DNA repair and cancer proliferation.
Figure 1.
Polθ-helicase unwinds DNA in an ATP- and dATP-dependent manner. A, schematic of Polθ. B, denaturing SDS gel of purified Polθ-helicase. C, schematic of unwinding assay (left). Non-denaturing gel showing Polθ-helicase unwinding of the indicated DNA substrate with a 3′ ssDNA overhang (right). D, non-denaturing gel showing Polθ-helicase unwinding of the indicated DNA substrate with a 5′ ssDNA overhang. E and F, non-denaturing gels showing Polθ-helicase DNA unwinding in the presence of the indicated nucleotides. % unwinding is indicated. G, SDS gel of purified Polθ-helicase K121M (left). Non-denaturing gel showing the lack of Polθ-helicase K121M DNA unwinding (right). *, 32P.
Although multiple studies have begun to elucidate the functions of the polymerase domain (Polθ-polymerase), very little is understood about the helicase domain (Polθ-helicase) which is a SF2 helicase member (Fig. 1A). For example, a seminal report investigating Polθ activities found that the helicase exhibits ATPase activity as predicted from its conserved helicase motifs (i.e. nucleotide binding, single-stranded DNA (ssDNA) binding, and core helicase motifs) (Fig. 1A) (16). However, although Polθ-helicase exhibits robust ATPase activity, the study failed to identify any DNA unwinding activity by the enzyme (16). Consistent with this, a more recent study reported that Polθ-helicase is unable to unwind DNA (17). Interestingly, Ceccaldi et al. (10) reported that Polθ-helicase interacts with RAD51 via specific binding motifs and exhibits anti-recombinase activity because of its ability to counter RAD51 activity. Despite these initial findings, the biochemical and cellular functions of Polθ-helicase have yet to be fully elucidated.
Because Polθ-helicase is most closely related to HELQ/Hel308-type and RecQ-type helicases, it likely shares activities with these widely studied groups of motor proteins (1,18). For example, many RecQ helicases exhibit both DNA unwinding and annealing activities (19). Because these mechanisms can compete with one another, they can also mask each other in biochemical assays. For example, in recent studies we found that Polθ-helicase exhibits DNA annealing activity, similar to RecQ-type helicases (20). Specifically, Polθ-helicase promotes ssDNA annealing in an ATP-independent manner in the absence of the ssDNA-binding protein RPA (20). However, when RPA is prebound to ssDNA, Polθ-helicase requires ATP hydrolysis to promote ssDNA annealing (20). These studies link the ATP-dependent annealing activity of the helicase to alt-EJ by showing that it counteracts RPA to promote end-joining (20) (reviewed in Ref. 21).
Because Polθ-helicase promotes DNA annealing, we envisaged that this activity likely opposes its unwinding function, and if so this would explain why DNA unwinding by the helicase has been difficult to detect. Indeed, here we demonstrate that by masking ssDNA annealing, we observe that Polθ-helicase efficiently unwinds several different types of DNA substrates with 3′–5′ polarity, including replication forks, blunt-ended DNA, and DNA with 3′ or 5′ overhangs. We further demonstrate that Polθ-helicase efficiently unwinds RNA-DNA hybrids and preferentially displaces the lagging strand from model replication forks, similar to the related HELQ/Hel308 helicase. These findings suggest Polθ-helicase DNA unwinding contributes to the many activities of Polθ in genome maintenance, and highlight a new activity for this enigmatic multifunctional enzyme.
Results
Polθ-helicase unwinds DNA in an ATP- and dATP-dependent manner
Considering that Polθ-helicase exhibits annealing activity like related RecQ-type helicases (20), it can conceivably rewind DNA after unwinding it, which would prevent detection of its unwinding function. We therefore developed an assay that would mask the annealing activity immediately following DNA unwinding by the helicase. Polθ-helicase (residues 1–894) was expressed and purified from Escherichia coli using a N-terminal tandem hexahistidine-SUMO tag which was subsequently cleaved (Fig. 1B) (20). The purified helicase was incubated with a radiolabeled DNA substrate containing a 3′ ssDNA overhang, referred to as partial ssDNA (pssDNA), in standard buffer conditions in the presence of MgCl2 (Fig. 1C). Next, the ATPase activity of the helicase was initiated by adding ATP along with excess ssDNA trap that is identical to the short strand within the pssDNA substrate. Here, if the helicase unwinds the DNA duplex, then the excess unlabeled ssDNA trap will preferentially anneal to the complementary long strand within the pssDNA substrate. Consistent with this, we detected helicase-dependent unwinding in the presence of the ssDNA trap (Fig. 1C), and show that excess sequence-specific ssDNA trap is essential for detection of Polθ-helicase unwinding (Fig. S1A). To our knowledge, these data are the first to document Polθ-helicase unwinding.
Next, we utilized the optimized unwinding assay to further characterize the enzyme's unwinding activity on various substrates. Unexpectedly, we observed that the helicase is able to unwind substrates containing 3′ and 5′ overhangs with similar efficiency (compare Fig. 1, C and D). Although related SF2 enzymes such as HELQ, also known as Hel308, translocate along ssDNA with a 3′–5′ polarity (18), our data presented so far fail to reveal a particular polarity exhibited by Polθ-helicase. Nevertheless, we proceeded to determine which nucleotide cofactors support the enzyme's unwinding activity. The results show that the helicase exclusively utilizes nucleotides containing adenine, but more efficiently unwinds DNA in the presence of ATP compared with dATP (Fig. 1E). We further find that the Polθ-helicase is unable to unwind DNA in the presence of the nonhydrolyzable ATP analogue AMP-PNP which demonstrates that the enzyme harnesses the energy of ATP hydrolysis to unwind DNA as expected (Fig. 1F). Lastly, we demonstrate that Polθ-helicase possessing a mutation of a highly conserved lysine (K121M) within the Walker A motif known to be essential for ATP binding fails to unwind DNA as expected (Fig. 1G). Taken together, the data presented in Fig. 1 clearly show that Polθ-helicase exhibits robust DNA unwinding activity that depends on hydrolysis of ATP or dATP.
Polθ-helicase preferentially unwinds DNA with 3′ overhangs
Although Polθ-helicase demonstrated a similar ability to unwind DNA containing a 3′ or 5′ ssDNA overhang, it would be unprecedented for such an enzyme to actively translocate along ssDNA in both directions. Thus, an alternative interpretation of the data presented in Fig. 1, C and D is that Polθ-helicase actively translocates along ssDNA with a single polarity, but is capable of initiating unwinding at blunt or 3′ recessed ends. To further investigate the enzyme's ATP-dependent directional movement, we assayed unwinding on 3′ and 5′ overhang substrates that contain longer DNA duplexes to increase the energy barrier to unwinding (Fig. 2A). For example, the substrates used in Fig. 1 include a duplex region 15 base pairs (bp) in length, whereas the substrates used in the current figure contain 23 bp of double strand DNA. Importantly, the 23-bp duplex sequence on the 3′ and 5′ overhang substrates is identical to prevent differences in melting temperature, and thus the amount of energy required for unwinding. The results demonstrate that Polθ-helicase unwinds the 3′ overhang substrate, but not the 5′ overhang substrate, indicating a 3′–5′ polarity, similar to related HELQ/Hel308 (Fig. 2A) (18).
Figure 2.
Polθ-helicase preferentially unwinds DNA with 3′ overhangs. A, non-denaturing gels showing Polθ-helicase unwinding of DNA substrates containing 3′ (left) and 5′ (right) ssDNA overhangs. B–E, non-denaturing gel showing a time course of Polθ-helicase unwinding of the indicated DNA substrates. F, plot showing rate of Polθ-helicase unwinding of the DNA substrates from B--E. Data represent mean, n = 3 ± S.D. G, non-denaturing gel showing RPA stimulation of Polθ-helicase unwinding (left). Bar chart showing % unwinding by indicated proteins (right). n = 3 ± S.D. ***, < 0.001 p value, Student's unpaired t test. % unwinding is indicated. *, 32P.
The rate of unwinding by the helicase was next examined on multiple substrates to potentially identify its preference for a particular substrate. We utilized identical conditions to assay the enzyme on pssDNA containing 3′ or 5′ overhangs, duplex DNA, and a replication fork (Fig. 2, B–E). Here again, we employed substrates with the same double strand DNA sequence and thus identical melting temperature. The results show that although the helicase unwinds each substrate under identical conditions, it exhibits the highest rate of unwinding on pssDNA harboring a 3′ overhang, which is consistent with 3′–5′ directional movement along ssDNA (Fig. 2F). We presume the enzyme unwinds the replication fork at a slower rate because of a second enzyme acting on the 5′ overhang that can conceivably impede helicase translocation on the 3′ overhang. Taken together, the results presented so far in Fig. 2 demonstrate that Polθ-helicase preferentially unwinds DNA containing 3′ overhangs, but is also capable of unwinding double strand DNA, DNA with 5′ overhangs, and replication forks. We note that although the enzyme can unwind blunt-ended DNA substrates, it fails to do so on longer substrates even at relatively high concentrations (Fig. S1B). This suggests that multiple Polθ-helicase molecules are unable to act cooperatively to unwind long substrates, as indicated for SF1-type helicase UvrD (22). Because many helicases function with and are stimulated by the ssDNA binding protein RPA, we assessed whether RPA promotes Polθ-helicase unwinding activity in Fig. 2G. Here, we determined the efficiency of unwinding the 23-bp duplex substrate by relatively low amounts of either Polθ-helicase, RPA, or both proteins combined. The results show that the addition of both proteins results in synergistic activity which is indicated by a significantly higher yield of unwound DNA (Fig. 2G). Future studies will be required to determine whether RPA stimulation of Polθ-helicase occurs by a specific protein-protein interaction.
Several lines of evidence indicate the involvement of RNA-DNA structures in contributing to both genome instability and DNA repair. For example, R-loops have long been associated with replicative stress and genome instability, whereas more recent work indicates that RNA-DNA hybrids can also promote DNA repair by mechanisms that remain to be elucidated (23–27). Considering the importance of RNA-DNA structures in DNA repair and genome instability, we proceeded to examine whether Polθ-helicase unwinds RNA-DNA duplexes with similar efficiency. Indeed, using identical substrate sequences, our results show that RNA-DNA substrates are also efficiently unwound by Polθ-helicase (Fig. 3, A and B). Here again, the enzyme more rapidly unwinds the substrate containing a 3′ overhang (Fig. 3A). We note that the helicase shows substantially lower efficiency of unwinding a blunt-ended RNA-DNA duplex (Fig. 3C). This is consistent with inefficient unwinding of a blunt-ended DNA-DNA duplex (see Fig. 2D). Failure of Polθ-helicase to unwind a RNA-DNA substrate containing a 3′ RNA overhang indicates that this enzyme exclusively translocates along ssDNA (Fig. 3D). The helicase also fails to unwind a RNA-RNA substrate, which further demonstrates its inability to translocate along RNA (Fig. 3E).
Figure 3.
Polθ-helicase unwinds RNA-DNA hybrids. A–E, non-denaturing gels showing a time course of Polθ-helicase unwinding of the indicated RNA-DNA and RNA-RNA substrates. Gray line, RNA oligonucleotide. Black line, DNA oligonucleotide. % unwinding is indicated. *, 32P.
Polθ-helicase efficiently unwinds substrates modeled after stalled replication forks
A previous report demonstrates that mammalian Polθ acts in response to replication stress and promotes replication fork progression or fork stability (10). For example, Polθ was shown to form cellular foci in response to ultraviolet light and confer cellular resistance to hydroxyurea treatment (10). Furthermore, Polθ was demonstrated to promote replication fork progression in the absence of exogenous DNA damaging agents, and cells deficient in Polθ exhibit a prolonged S phase delay and a significant increase in stalled or collapsed forks following hydroxyurea treatment (10). Thus, although Polθ has an essential role in alt-EJ, additional lines of evidence suggest it might exhibit separate functions in response to replicative stress, such as replication fork restart (10).
We further examined Polθ-helicase activity on different types of replication forks to provide insight into its potential functions during replication. Time courses of Polθ-helicase unwinding were performed on replication forks containing leading or lagging strands, leading and lagging strands, or a fork lacking leading and lagging strands (Fig. 4A). The results clearly show that the helicase preferentially unwinds the fork containing the lagging strand but lacking the leading strand (Fig. 4A, Fork B). These data suggest a possible function for Polθ-helicase in replication fork repair. For example, following arrest of the leading strand polymerase, such as because of an encounter with a lesion, the replicative helicase is known to continue to unwind the fork, resulting in a large leading strand gap. In contrast, the lagging strand polymerase can continue to act on its respective template, generating Okazaki fragments (29). Hence, fork collapse is often modeled as Fork B which specifically lacks a leading strand. We next investigated whether Polθ-helicase more efficiently unwinds the lagging strand which is common among Hel308-type enzymes. Indeed, similar to HELQ/Hel308 activity, we find that Polθ-helicase preferentially unwinds the lagging strand at a replication fork which further supports a potential role in response to replication stress like HELQ/Hel308 (Fig. 4B).
Figure 4.
Polθ-helicase unwinding activity at replication forks. A, non-denaturing gel showing a time course of Polθ-helicase unwinding of the indicated DNA replication fork substrates. B, non-denaturing gel showing a time course of Polθ-helicase unwinding of the indicated DNA replication fork substrates containing leading (left) or lagging (right) strands. % unwinding is indicated. Plot of % unwinding data from left and middle panels (right). C, denaturing gel showing Polθ-polymerase leading strand extension in the presence (lane 3) and absence (lane 2) of Polθ-helicase. % run-off product is indicated. *, 32P.
Polθ-helicase promotes strand displacement synthesis by Polθ-polymerase
A unique feature of POLQ is that it is the only known gene in multicellular organisms to encode for a helicase and a polymerase. Other known helicase-polymerase fusion proteins are more common in bacteria, archaea, and viruses, and are involved in replication and repair (30). A conceivable function for Polθ-helicase unwinding activity is to facilitate strand displacement synthesis by the Polθ-polymerase domain. For example, although some polymerases exhibit proficient strand displacement activity, which enables DNA unwinding downstream of the 3′ primer terminus during replication, many polymerases such as those involved in chromosomal replication require the unwinding activity of auxiliary helicases to perform replication of double strand DNA. We tested whether Polθ-polymerase exhibits strand displacement activity on a replication fork containing a leading strand in Fig. 4C. The results show that the polymerase possesses limited strand displacement activity in the presence of all four dNTPs and ATP as indicated by its inability to fully extend the leading strand primer (Fig. 4C, lane 2). Given that Polθ-helicase exhibits 3′–5′ polarity, we evaluated whether it promotes strand displacement activity by the polymerase domain. Indeed, addition of the helicase under identical conditions with ATP facilitates Polθ-polymerase primer extension through the downstream DNA duplex, as indicated by a 4-fold increase in run-off product (Fig. 4C, lane 3). Hence, these data suggest a plausible function for the helicase domain in facilitating Polθ-polymerase strand displacement synthesis during replication repair.
Discussion
Polθ has multiple documented activities in DNA replication and repair, including alt-EJ, replication repair, translesion synthesis, and replication initiation (4–8, 10, 15, 31, 32). Although the activities and cellular functions of Polθ-polymerase have been investigated, little is understood regarding the enzymatic activities of Polθ-helicase. For example, although studies have shown that the helicase exhibits ATPase activity that is stimulated by ssDNA, multiple reports failed to detect a DNA unwinding function which is common among DNA helicases sharing sequence homology to Polθ, such as HELQ/Hel308- and RecQ-type helicases (10, 16–18, 28, 33–35). In this report, we demonstrate that Polθ-helicase exhibits robust DNA unwinding activity with 3′–5′ directionality. The helicase preferentially unwinds DNA substrates containing 3′ ssDNA overhangs, but additionally unwinds substrates with 5′ overhangs, blunt-ended DNA, RNA-DNA hybrids, and replication forks. Because Polθ-helicase also performs ssDNA annealing (20), this function counters its unwinding which likely explains why Polθ unwinding has been difficult to detect in previous studies (16, 17).
Several lines of evidence have supported a role for Polθ in replication fork repair. For example, a recent report demonstrated that suppression of Polθ significantly slows the velocity of replication forks even in the absence of exogenous DNA damaging agents (10). This report also shows that knockdown of Polθ expression impairs fork progression and halts cells in S-phase following hydroxyurea treatment (10). These data indicate that Polθ either promotes replication fork stability or replication fork repair. Considering that several SF2 helicases, such as HELQ/Hel308 and RecQ subclasses, are involved in replication fork repair, it is not unreasonable to assume a similar function for Polθ-helicase, which is closest in relation to HELQ/Hel308 (18, 28, 36–38). For example, prior studies showed that mammalian HELQ/Hel308 is recruited to stalled replication forks and is involved in repairing interstrand cross-links which arrest replication forks (28, 37, 38). Similar to HELQ/Hel308, Polθ-helicase unwinds DNA with 3′–5′ polarity and exhibits a preference for unwinding substrates modeled after collapsed replication forks, such as those lacking a leading strand (28, 35). We also find that Polθ-helicase is unable to unwind long substrates and thus exhibits nonprocessive unwinding activity like HELQ/Hel308 (18, 35). Hence, our studies confirm similar biochemical activities between Polθ-helicase and HELQ/Hel308 which suggests these enzymes perform similar replication repair functions.
Structural and sequence comparisons between Polθ-helicase and Hel308-type enzymes provide further evidence for shared mechanisms of helicase activity (Fig. 5). For example, superposition of Polθ-helicase and the co–crystal structure of Hel308 in complex with partially unwound DNA reveals a similar orientation of the β-hairpin motif, previously shown to act as a wedge to facilitate duplex unwinding by Hel308 (Fig. 5B) (39). Although the sequence of this motif is not closely conserved between Polθ-helicase– and HELQ/Hel308-type enzymes (Fig. 5A), superposition of Polθ-helicase and Hel308 suggests the slightly smaller β-hairpin in Polθ facilitates DNA duplex separation by a similar mechanism (Fig. 5B). Another interesting structural similarity between these enzymes is the previously reported auto-inhibitory helix-loop-helix domain 5 which contains a highly conserved Arg-Ala-Arg (RAR) motif (Fig. 5C) (35, 39). For instance, a prior report demonstrated that domain 5 within Hel308 suppresses its unwinding activity (35). Specifically, deletion of this domain or mutation of a conserved arginine (Arg-662) in this region, which was shown to interact with extruded ssDNA in the co–crystal structure of Hel308 in complex with partially unwound DNA, resulted in a dramatic increase in helicase activity (35, 39). These types of helicase autoinhibitory domains found in both SF1 and SF2 members may be modulated by interacting proteins or specific nucleic acid structures (35). Thus, Polθ-helicase activity may be substantially stimulated by protein or DNA interactions that change the orientation of the autoinhibitory domain. We speculate that the structurally and sequence conserved domain 5 in Polθ-helicase exhibits an autoinhibitory mechanism like Hel308 (Fig. 5C).
Figure 5.
Sequence and structural comparison of Polθ-helicase and HELQ/Hel308 enzymes. A, sequence alignment of motifs IVa–VI of Polθ/Hel308/Ski2-related SF2 helicases. β-hairpin, motifs IV–VI, and secondary structures are indicated. *, identical residues; colon (:), residues sharing very similar properties; period (.), residues sharing some properties; red, small and hydrophobic; blue, acidic; magenta, basic; green, hydroxyl, sulfhydryl, amine. Sequences were aligned using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/)3 default settings. B, superposition of Polθ-helicase (green) (PDB ID: 5AGA) and Hel308 in complex with DNA (blue) (PDB ID: 2P6R) highlighting the β-hairpin motif. C, superposition of Polθ-helicase (green) (PDB ID: 5AGA) and Hel308 (blue) (PDB ID: 2VA8) highlighting the conserved Ala-Arg-Ala (RAR) motif in domain 5. Conserved arginines are represented as sticks.
Despite the similar unwinding activities between Polθ and HELQ/Hel308, DNA unwinding is countered by the annealing function of Polθ-helicase. For instance, detection of DNA unwinding by Polθ-helicase requires masking the opposite annealing activity by addition of excess ssDNA trap. In contrast, HELQ/Hel308 has been shown to unwind DNA in the absence of a ssDNA trap and therefore does not likely exhibit strong annealing activity like Polθ-helicase (28). Interestingly, other SF2 helicases, such as those from the RecQ subclass, exhibit ssDNA annealing, however, in many cases this activity is suppressed by ATP (19). In contrast, the respective annealing activities of Polθ and RECQL5 helicases are not suppressed by ATP, and these enzymes share ∼18% sequence homology (1, 20). RECQL5 also unwinds DNA with low processivity like Polθ-helicase (40). Despite these similarities, we were unable to detect strand exchange activity by Polθ-helicase which RECQL5 has been shown to exhibit (Fig. S1C). Another similar function between Polθ-helicase and RECQL5 is their ability to interact with RAD51 and counteract its activity. For example, both Polθ-helicase and RECQL5 promote dissociation of RAD51-mediated D-loops in vitro, and these enzymes suppresses homologous recombination in cells (10, 41). Taken together, Polθ-helicase shares similar characteristics with RECQL5 and HELQ/Hel308.
Because Polθ is known to promote the proliferation of BRCA-deficient cancer cells and is considered a promising oncology drug target, it will be important to determine whether the unwinding function of the helicase domain contributes to cancer cell survival (4, 10). For example, although the helicase domain was recently shown to promote alt-EJ via annealing and counteracting RPA, its unwinding activity may also contribute to this pathway (20). For example, Polθ-helicase unwinding may enable microhomology annealing or strand displacement synthesis by Polθ-polymerase during alt-EJ (Fig. 6A). Because Polθ-polymerase exhibits poor strand displacement synthesis, DNA unwinding ahead of the polymerase would be a plausible function for the helicase during alt-EJ (Fig. 6A). Considering that RNA-DNA hybrids have recently been shown to form at DNA breaks, Polθ-helicase dissociation of these structures may also contribute to DSB repair (27).
Figure 6.
Models of Polθ-helicase activity during replication and repair. A, model of Polθ-helicase activity during alt-EJ. Polθ-helicase dissociates RPA in an ATP-dependent manner, then facilitates DNA synapse/annealing and Polθ-polymerase strand displacement synthesis. Polθ-helicase unwinding may also enable microhomology annealing. B, models of Polθ-helicase activity during replication fork repair. Polθ-helicase performs lagging strand unwinding at collapsed replication forks (left). Polθ-helicase DNA unwinding enables strand displacement synthesis by Polθ-polymerase during replication restart (right).
Importantly, it remains unclear whether alt-EJ independent roles for Polθ-helicase exist and enable the proliferation of BRCA-deficient cells. For example, although a previous report suggested Polθ-helicase suppresses homologous recombination via its RAD51 interaction motif (10), a more recent study was unable to confirm this mechanism in cells (20). Because Polθ-helicase exhibits robust unwinding of replication forks, it can conceivably play a compensatory role in BRCA-deficient cells during replication repair. For instance, lagging strand unwinding can contribute to fork reversal and replication restart (Fig. 6B, left). Alternatively, the helicase can potentially promote replication by facilitating strand displacement synthesis by the polymerase domain (Fig. 6B, right). This activity could conceivably aid in replication restart by extending nascent primers. Future studies will be required to further characterize the molecular basis of Polθ-helicase unwinding and determine whether this activity contributes to the many functions of Polθ in replication and repair.
Experimental procedures
Nucleic acid unwinding
5 nm 32P-5′–radiolabeled DNA, RNA-DNA, or RNA templates were preincubated at room temperature in buffer (25 mm Hepes-NaOH, pH 7.0, 2 mm DTT, 0.01% Nonidet P-40, 40 mm KCl, 5% glycerol, 1 mm MgCl2) then mixed with the indicated amounts of Polθ-helicase for 5 min. This was followed by the addition of 2 mm ATP and 200 nm ssDNA trap for the indicated times at 30 °C in a total volume of 20 μl. Reactions were terminated by the addition of 4 μl of non-denaturing stop buffer (0.2 m Tris-HCl, pH 7.5, 10 mg/ml proteinase K, 100 mm EDTA, and 0.5% SDS) then resolved in non-denaturing 12% polyacrylamide gels and visualized by phosphorimaging (Fujifilm FLA 7000) or autoradiography. For RPA stimulation experiments, the indicated amounts of RPA were pre-incubated with DNA for 5 min, then the indicated amounts of Polθ-helicase were added for an additional 5 min. Reactions were then initiated as above. Unwinding experiments utilizing substrates with a 23-bp duplex were incubated at 37 °C.
Sequence alignment
The indicated amino acid sequences of the helicase domain of Homo sapiens Polθ and other indicated SF2/Ski2 family helicases were aligned using Clustal Omega (European Bioinformatics Institute) (http://www.ebi.ac.uk/Tools/msa/clustalo/)3 default settings (44). Location and numbers of β-sheets and α-helices are indicated for Polθ-helicase domain based on previous structural analysis (17).
Superposition of Polθ-helicase and Hel308 structures
The Cα-bound form of Hel308 (PDB ID: 2P6R) was used as reference onto which the Polθ-helicase domain (PDB ID: 5AGA) was superimposed using Swiss-PdbViewer (42). Using least squares fitting option, 1432 matching atoms were found to superimpose with a root mean square deviation (RMSD) of 1.55 Å. Images were generated with PyMOL software (43).
Polθ strand displacement synthesis
10 nm 32P-5′–radiolabeled DNA pre-incubated at room temperature in 25 mm Tris-HCl, pH 8.8, 1 mm DTT, 0.01% Nonidet P-40, 0.1 mg/ml BSA, 10% glycerol, 10 mm MgCl2 was mixed with or without 50 nm Polθ-helicase. Next, 2 mm ATP and 20 μm dNTPs were added along with 400 nm unlabeled ssDNA trap for 30 min at 30 °C. Polθ-polymerase was added for an additional 20 min in a total volume of 20 μl. Reactions were terminated by the addition of 20 μl of 2× denaturing stop buffer (90% formamide and 50 mm EDTA) then resolved in denaturing urea polyacrylamide gels and visualized by phosphorimaging (Fujifilm FLA 7000).
DNA and RNA
Templates are as follows: Figs. 1, C, E, F, and G and 2B, RP469D/RP470D. Figs. 1D and 2C, RP469D/RP484. Fig. 2A, AO8/AO1, AO8/AO10. Fig. 2G, AO8/AO1. Fig. 2D, RP469D/RP469DC. Fig. 2E, RP470D/RP485. Fig. 3A, RP469R/RP470D. Fig. 3B, RP469R/RP484. Fig. 3C, RP469R/RP469DC. Fig. 3E, RP469R/RP470R. Fig. 3D, RP469D/RP470R. Fig. 4A, Fork A, RP470D/AO12/RP485; Fork B, RP470D/RP485/AO13; Fork C, RP470D/AO12/RP485/AO13; Fork D, RP470D/RP485. Fig. 4B, Leading strand fork, RP470D/AO12/AO18; Lagging strand fork, RP470D/AO17/AO19. Fig. 4C, RP470D/AO12/RP485. DNA and RNA were 32P-5′–radiolabeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP (PerkinElmer Life Sciences). Substrates were annealed by mixing a ratio of 1:2 short to long strands then boiling and slow cooling to room temperature.
DNA and RNA oligonucleotides (Integrated DNA Technologies) are as follows (5′–3′): RP469D, CTGTCCTGCATGATG; RP469R, CUGUCCUGCAUGAUG; RP469DC, CATCA TGCAGGACAG; RP470D, CATCATGCAGG ACAGTCGGATCGCAGTCAG; RP470R, CAUCAUGCAGGACAGUCGGAUCGCAGUCAG; RP484, TCGGATCGCAGTCAGCATC ATGCAGGACAG; AO8, CATGCTGTCTAGA GACTATCGAT; AO1, ATCGATAGTCTCTA GACAGCATGTCCTAGCAAGCCAGAATTCGGCAGCGT; AO10, TCCTAGCAAGCCAGA ATTCGGCAGCGTATCGATAGTCTCTAGACAGCATG; RP485, TTTTCGCCTTTTGCTCT GTCCTGCATGATG; AO12, CTGACTGCGA TCCGA; AO13, AGCAAAAGGCGAAAA; AO17, TGCATCTAGAGGGCTCTGTCCTGC ATGATG; AO18, TGCATTCGAATTACT CTG TCCTGCATGATG; AO19, AGCCCTCTAGATGCA.
Proteins
Polθ-helicase, Polθ-polymerase, and RPA were purified as described (20). Ambion RNase inhibitor was purchased from Thermo Fisher Scientific.
Author contributions
A. Y. O., T. R., T. K., and L. A. S. data curation; A. Y. O. investigation; A. Y. O., T. R., and T. K. methodology; R. T. P. conceptualization; R. T. P. supervision; R. T. P. funding acquisition; R. T. P. writing-original draft; R. T. P. project administration.
Supplementary Material
This work was supported by National Institutes of Health Grant 1R01GM115472-01 (to R. T. P.). The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
This article contains Fig. S1 and supporting information.
Please note that the JBC is not responsible for the long-term archiving and maintenance of this site or any other third party hosted site.
- DSB
- double-strand break
- alt-EJ
- alternative end-joining
- SUMO
- small ubiquitin-like modifier
- pssDNA
- partial ssDNA
- AMP-PNP
- adenosine 5′-(β,γ-imino)triphosphate.
References
- 1. Black S. J., Kashkina E., Kent T., and Pomerantz R. T. (2016) DNA polymerase θ: A unique multifunctional end-joining machine. Genes 7, 67 10.3390/genes7090067 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Wood R. D., and Doublié S. (2016) DNA polymerase θ(POLQ), double-strand break repair, and cancer. DNA Repair 44, 22–32 10.1016/j.dnarep.2016.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Sfeir A., and Symington L. S. (2015) Microhomology-mediated end joining: A back-up survival mechanism or dedicated pathway? Trends Biochem. Sci. 40, 701–714 10.1016/j.tibs.2015.08.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Mateos-Gomez P. A., Gong F., Nair N., Miller K. M., Lazzerini-Denchi E., and Sfeir A. (2015) Mammalian polymerase θ promotes alternative NHEJ and suppresses recombination. Nature 518, 254–257 10.1038/nature14157 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Yousefzadeh M. J., Wyatt D. W., Takata K., Mu Y., Hensley S. C., Tomida J., Bylund G. O., Doublié S., Johansson E., Ramsden D. A., McBride K. M., and Wood R. D. (2014) Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. PLoS Genet. 10, e1004654 10.1371/journal.pgen.1004654 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Chan S. H., Yu A. M., and McVey M. (2010) Dual roles for DNA polymerase θ in alternative end-joining repair of double-strand breaks in Drosophila. PLoS Genet. 6, e1001005 10.1371/journal.pgen.1001005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Kent T., Chandramouly G., McDevitt S. M., Ozdemir A. Y., and Pomerantz R. T. (2015) Mechanism of microhomology-mediated end-joining promoted by human DNA polymerase θ. Nat. Struct. Mol. Biol. 22, 230–237 10.1038/nsmb.2961 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Koole W., van Schendel R., Karambelas A. E., van Heteren J. T., Okihara K. L., and Tijsterman M. (2014) A polymerase θ-dependent repair pathway suppresses extensive genomic instability at endogenous G4 DNA sites. Nat. Commun. 5, 3216 10.1038/ncomms4216 [DOI] [PubMed] [Google Scholar]
- 9. Wyatt D. W., Feng W., Conlin M. P., Yousefzadeh M. J., Roberts S. A., Mieczkowski P., Wood R. D., Gupta G. P., and Ramsden D. A. (2016) Essential roles for polymerase θ-mediated end joining in the repair of chromosome breaks. Mol. Cell 63, 662–673 10.1016/j.molcel.2016.06.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Ceccaldi R., Liu J. C., Amunugama R., Hajdu I., Primack B., Petalcorin M. I. R., O'Connor K. W., Konstantinopoulos P. A., Elledge S. J., Boulton S. J., Yusufzai T., and D'Andrea A. D. (2015) Homologous-recombination-deficient tumours are dependent on Polθ-mediated repair. Nature 518, 258–262 10.1038/nature14184 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Zelensky A. N., Schimmel J., Kool H., Kanaar R., and Tijsterman M. (2017) Inactivation of Pol θ and C-NHEJ eliminates off-target integration of exogenous DNA. Nat. Commun. 8, 66 10.1038/s41467-017-00124-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. van Kregten M., de Pater S., Romeijn R., van Schendel R., Hooykaas P. J., and Tijsterman M. (2016) T-DNA integration in plants results from polymerase-θ-mediated DNA repair. Nat. Plants 2, 16164 10.1038/nplants.2016.164 [DOI] [PubMed] [Google Scholar]
- 13. Saito S., Maeda R., and Adachi N. (2017) Dual loss of human POLQ and LIG4 abolishes random integration. Nat. Commun. 8, 16112 10.1038/ncomms16112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Thyme S. B., and Schier A. F. (2016) Polq-mediated end joining is essential for surviving DNA double-strand breaks during early zebrafish development. Cell Rep. 15, 1611–1613 10.1016/j.celrep.2016.04.089 [DOI] [PubMed] [Google Scholar]
- 15. Fernandez-Vidal A., Guitton-Sert L., Cadoret J. C., Drac M., Schwob E., Baldacci G., Cazaux C., and Hoffmann J. S. (2014) A role for DNA polymerase θ in the timing of DNA replication. Nat. Commun. 5, 4285 10.1038/ncomms5285 [DOI] [PubMed] [Google Scholar]
- 16. Seki M., Marini F., and Wood R. D. (2003) POLQ (Pol θ), a DNA polymerase and DNA-dependent ATPase in human cells. Nucleic Acids Res. 31, 6117–6126 10.1093/nar/gkg814 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Newman J. A., Cooper C. D., Aitkenhead H., and Gileadi O. (2015) Structure of the helicase domain of DNA polymerase θ reveals a possible role in the microhomology-mediated end-joining pathway. Structure 23, 2319–2330 10.1016/j.str.2015.10.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Marini F., and Wood R. D. (2002) A human DNA helicase homologous to the DNA cross-link sensitivity protein Mus308. J. Biol. Chem. 277, 8716–8723 10.1074/jbc.M110271200 [DOI] [PubMed] [Google Scholar]
- 19. Khadka P., Croteau D. L., and Bohr V. A. (2016) RECQL5 has unique strand annealing properties relative to the other human RecQ helicase proteins. DNA Repair 37, 53–66 10.1016/j.dnarep.2015.11.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Mateos-Gomez P. A., Kent T., Deng S. K., McDevitt S., Kashkina E., Hoang T. M., Pomerantz R. T., and Sfeir A. (2017) The helicase domain of Polθ counteracts RPA to promote alt-NHEJ. Nat. Struct. Mol. Biol. 24, 1116–1123 10.1038/nsmb.3494 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Campbell J. L., and Li H. (2017) Polθ helicase: Drive or reverse. Nat. Struct. Mol. Biol. 24, 1007–1008 10.1038/nsmb.3510 [DOI] [PubMed] [Google Scholar]
- 22. Runyon G. T., and Lohman T. M. (1989) Escherichia coli helicase II (uvrD) protein can completely unwind fully duplex linear and nicked circular DNA. J. Biol. Chem. 264, 17502–17512 [PubMed] [Google Scholar]
- 23. Sollier J., Stork C. T., García-Rubio M. L., Paulsen R. D., Aguilera A., and Cimprich K. A. (2014) Transcription-coupled nucleotide excision repair factors promote R-loop-induced genome instability. Mol. Cell 56, 777–785 10.1016/j.molcel.2014.10.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Keskin H., Shen Y., Huang F., Patel M., Yang T., Ashley K., Mazin A. V., and Storici F. (2014) Transcript-RNA-templated DNA recombination and repair. Nature 515, 436–439 10.1038/nature13682 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Aguilera A., and García-Muse T. (2012) R loops: From transcription byproducts to threats to genome stability. Mol. Cell 46, 115–124 10.1016/j.molcel.2012.04.009 [DOI] [PubMed] [Google Scholar]
- 26. Plosky B. S. (2016) The good and bad of RNA:DNA hybrids in double-strand break repair. Mol. Cell 64, 643–644 10.1016/j.molcel.2016.11.010 [DOI] [PubMed] [Google Scholar]
- 27. Ohle C., Tesorero R., Schermann G., Dobrev N., Sinning I., and Fischer T. (2016) Transient RNA-DNA hybrids are required for efficient double-strand break repair. Cell 167, 1001–1013.e7 10.1016/j.cell.2016.10.001 [DOI] [PubMed] [Google Scholar]
- 28. Tafel A. A., Wu L., and McHugh P. J. (2011) Human HEL308 localizes to damaged replication forks and unwinds lagging strand structures. J. Biol. Chem. 286, 15832–15840 10.1074/jbc.M111.228189 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Pagès V., and Fuchs R. P. (2003) Uncoupling of leading- and lagging-strand DNA replication during lesion bypass in vivo. Science 300, 1300–1303 10.1126/science.1083964 [DOI] [PubMed] [Google Scholar]
- 30. Guilliam T. A., Keen B. A., Brissett N. C., and Doherty A. J. (2015) Primase-polymerases are a functionally diverse superfamily of replication and repair enzymes. Nucleic Acids Res. 43, 6651–6664 10.1093/nar/gkv625 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Hogg M., Seki M., Wood R. D., Doublié S., and Wallace S. S. (2011) Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts. J. Mol. Biol. 405, 642–652 10.1016/j.jmb.2010.10.041 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Yoon J. H., Roy Choudhury J., Park J., Prakash S., and Prakash L. (2014) A role for DNA polymerase θ in promoting replication through oxidative DNA lesion, thymine glycol, in human cells. J. Biol. Chem. 289, 13177–13185 10.1074/jbc.M114.556977 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Fairman-Williams M. E., Guenther U. P., and Jankowsky E. (2010) SF1 and SF2 helicases: Family matters. Curr. Opin. Struct. Biol. 20, 313–324 10.1016/j.sbi.2010.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Zhang L., Xu T., Maeder C., Bud L. O., Shanks J., Nix J., Guthrie C., Pleiss J. A., and Zhao R. (2009) Structural evidence for consecutive Hel308-like modules in the spliceosomal ATPase Brr2. Nat. Struct. Mol. Biol. 16, 731–739 10.1038/nsmb.1625 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Richards J. D., Johnson K. A., Liu H., McRobbie A. M., McMahon S., Oke M., Carter L., Naismith J. H., and White M. F. (2008) Structure of the DNA repair helicase hel308 reveals DNA binding and autoinhibitory domains. J. Biol. Chem. 283, 5118–5126 10.1074/jbc.M707548200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Croteau D. L., Popuri V., Opresko P. L., and Bohr V. A. (2014) Human RecQ helicases in DNA repair, recombination, and replication. Annu. Rev. Biochem. 83, 519–552 10.1146/annurev-biochem-060713-035428 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Takata K., Reh S., Tomida J., Person M. D., and Wood R. D. (2013) Human DNA helicase HELQ participates in DNA interstrand crosslink tolerance with ATR and RAD51 paralogs. Nat. Commun. 4, 2338 10.1038/ncomms3338 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Adelman C. A., Lolo R. L., Birkbak N. J., Murina O., Matsuzaki K., Horejsi Z., Parmar K., Borel V., Skehel J. M., Stamp G., D'Andrea A., Sartori A. A., Swanton C., and Boulton S. J. (2013) HELQ promotes RAD51 paralogue-dependent repair to avert germ cell loss and tumorigenesis. Nature 502, 381–384 10.1038/nature12565 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Büttner K., Nehring S., and Hopfner K. P. (2007) Structural basis for DNA duplex separation by a superfamily-2 helicase. Nat. Struct. Mol. Biol. 14, 647–652 10.1038/nsmb1246 [DOI] [PubMed] [Google Scholar]
- 40. Popuri V., Huang J., Ramamoorthy M., Tadokoro T., Croteau D. L., and Bohr V. A. (2013) RECQL5 plays co-operative and complementary roles with WRN syndrome helicase. Nucleic Acids Res. 41, 881–899 10.1093/nar/gks1134 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Hu Y., Raynard S., Sehorn M. G., Lu X., Bussen W., Zheng L., Stark J. M., Barnes E. L., Chi P., Janscak P., Jasin M., Vogel H., Sung P., and Luo G. (2007) RECQL5/Recql5 helicase regulates homologous recombination and suppresses tumor formation via disruption of Rad51 presynaptic filaments. Genes Dev. 21, 3073–3084 10.1101/gad.1609107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Guex N., and Peitsch M. C. (1997) SWISS-MODEL and the Swiss-PdbViewer: An environment for comparative protein modeling. Electrophoresis 18, 2714–2723 10.1002/elps.1150181505 [DOI] [PubMed] [Google Scholar]
- 43. DeLano W. L. (2002) Unraveling hot spots in binding interfaces: Progress and challenges. Curr. Opin. Struct. Biol. 12, 14–20 10.1016/S0959-440X(02)00283-X [DOI] [PubMed] [Google Scholar]
- 44. Li W., Cowley A., Uludag M., Gur T., McWilliam H., Squizzato S., Park Y. M., Buso N., and Lopez R. (2015) The EMBL-EBI bioinformatics web and programmatic tools framework. Nucleic Acids Res. 43, W580–W584 10.1093/nar/gkv279 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






