Skip to main content
. 2018 Mar 15;7:e32496. doi: 10.7554/eLife.32496

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
gene (Gaussia princeps) gLUC PMID: 18408930 AY015993.1 wild-type
gene (Gaussia princeps) gLUC PMID: 18408930 EU372000 human codon-optimised
cell line
(Trypanosoma brucei)
2T1 PMID: 16182389
transfected construct
(Trypanosoma brucei)
pRPa-iSL plasmid PMID: 18588918 69244 available from addgene.org
transfected construct
(Trypanosoma brucei)
pRPa plasmid PMID: 18588918
transfected construct
(Trypanosoma brucei)
pRPa-λ plasmid this paper see materials and methods
antibody α-gLUC New England Biolabs one in 1000
sequence-based reagent EUluc5 oligonucleotide this paper GATCCTGCAGCTCGAGATGAAGCCCACCGAGAACAACG
sequence-based reagent EUluc3 oligonucleotide this paper GATCGAATTCAGATCTAAGCTTTTACAGCTTCGAGTCGCCGCCGGCGCC
sequence-based reagent WTluc5 oligonucleotide this paper GATCCTCGAGATGAAACCAACTGAAAACAATG
sequence-based reagent WTluc3 oligonucleotide this paper GATCAAGCTTTTATAATTTACTATCACCACCGGCACCCTT
sequence-based reagent Lambda5 oligonucleotide this paper GATCAAGCTTTGCAGGGTGAGATTGTGGC
sequence-based reagent Lambda3 oligonucleotide this paper GATCGAATTCGCTCAGTTGTTCAGGAATATG
sequence-based reagent TUBF oligonucleotide this paper AGATCTTCAAACACTAGTTTAAGC
sequence-based reagent TUBR oligonucleotide this paper CATGATAAATAAATAGAAGTGCTTTGTTG
sequence-based reagent λF oligonucleotide this paper GATTCATAAGTTCCGCTGTGTGCCGCATCTC
sequence-based reagent λR oligonucleotide this paper GCTCAGTTGTTCAGGAATATGGTGCAGCAG
commercial assay or kit BioLux Gaussia luciferase New England Biolabs
software, algorithm Bowtie 2 PMID: 22388286
software, algorithm SAMtools PMID: 19505943
software, algorithm edgeR PMID: 19910308
software, algorithm CAI calculator http://www.umbc.edu//codon/cai/cais.php
software, algorithm ANACONDA http://bioinformatics.ua.pt/software/anaconda/
online database TriTrypDB, RRID:SCR_007043 http://tritrypdb.org/tritrypdb/