Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) |
C57BL/6J | MPI-CBG Animal Facility | ||
| Biological sample (Homo sapiens) |
fetal neocortex tissue (13 wpc) |
Universitätsklinikum Carl Gustav Carus Dresden |
||
| Antibody | anti-BrdU (mouse) | MPI-CBG Antibody Facility | (1:1000) | |
| Antibody | anti-GFP (chicken polyclonal) |
Abcam | Abcam Cat# ab13970, RRID:AB_300798 |
(1:1000) |
| Antibody | anti-PH3 (rat monoclonal) |
Abcam | Abcam Cat# ab10543, RRID:AB_2295065 |
(1:1000) |
| Antibody | anti-Tbr2 (mouse) | MPI-CBG Antibody Facility | (1:500) | |
| Antibody | anti-Sox2 (goat polyclonal) |
R + D Systems | R and D Systems Cat# AF2018, RRID:AB_355110 |
(1:500) |
| Antibody | anti-Ki67 (rabbit polyclonal) |
Abcam | Abcam Cat# ab15580, RRID:AB_443209 |
(1:500) |
| Antibody | anti-PCNA (mouse monoclonal) |
Millipore | Millipore Cat# CBL407, RRID:AB_93501 |
(1:500) |
| Antibody | Alexa Fluor 488-, 555- and 594-secondaries |
Molecular Probes | (1:500) | |
| Recombinant DNA reagent | pCAGGS | doi: 10.1126/science.aaa1975 | ||
| Recombinant DNA reagent | pCAGGS-GFP | doi: 10.1126/science.aaa1975 | ||
| Recombinant DNA reagent | pCAGGS-NOTCH2NL | this paper |
NOTCH2NL was PCR amplified from cDNA and cloned into pCAGGS |
|
| Sequence-based reagent | ARHGAP11B LNA probe | this paper | AGTCTGGTACACGCCCTTCTTTTCT | |
| Sequence-based reagent | DHRS4L2 LNA probe | this paper | AGACAGTGGCGGTTGCGTGA | |
| Sequence-based reagent | FAM182B LNA probe | this paper | GCAGGGATACACGGCTAT | |
| Sequence-based reagent | GTF2H2C LNA probe | this paper | TCAGACGGCCTGCC | |
| Software, algorithm | cutadapt (v1.15) | https://cutadapt.readthedocs.io/en/stable/ | RRID:SCR_011841 | |
| Software, algorithm | STAR (v2.5.2b) | https://github.com/alexdobin/STAR | RRID:SCR_015899 | |
| Software, algorithm | Bedtools | http://bedtools.readthedocs.io/en/stable/# | RRID:SCR_006646 | |
| Software, algorithm | R | The R Foundation | ||
| Software, algorithm | samtools | Genome Research Limited | RRID:SCR_002105 | |
| Software, algorithm | bowtie1 | http://bowtie-bio.sourceforge.net/index.shtml | RRID:SCR_005476 | |
| Software, algorithm | BioMart | Bioconductor | ||
| Software, algorithm | BLAT | http://genome.ucsc.edu/cgi-bin/hgBlat?command=start | RRID:SCR_011919 | |
| Software, algorithm | Kallisto | doi:10.1038/nbt.3519 | ||
| Software, algorithm | FastQC | Babraham Bioinformatics | RRID:SCR_014583 | |
| Software, algorithm | dupRadar | Bioconductor | ||
| Software, algorithm | DESeq2 | Bioconductor | RRID:SCR_015687 | |
| Software, algorithm | GeneTrail2 | https://genetrail2.bioinf.uni-sb.de | ||
| Other | CESAR | doi: 10.1093/nar/gkw210 |