| Antibodies |
| Anti-CGL (Anti-Cystathionase) |
Abcam |
Cat# Ab151769
|
| Anti-CBS |
Abcam |
Cat# Ab135626
|
| Anti-3MST (Anti-MPST) |
Sigma |
Cat# HPA001240 |
| Anti-ATF4 (Anti-CREB-2) |
Santa Cruz |
Cat# Sc-200 |
| Anti-beta Tubulin |
Cell Signaling |
Cat# 2128 |
| Anti-Actin |
Cell Signaling |
Cat# 4970 |
| HRP conjugated anti-rabbit |
Dako |
Cat# P044801-2 |
| Anti-CD31 |
BD Bioscience |
Cat# 557355 |
| Anti-HIF1a |
Cayman Chemical |
Cat# 10006421 |
| Anti-p-eIF2α Ser51 |
Cell Signaling |
Cat# 9712S |
| Anti-total eIF2α |
Cell Signaling |
Cat# 9722S |
| Anti-Tubulin |
Cell Signaling |
Cat# 2146S |
| Anti-CD31-APC |
Biolegend |
Cat# 102410 |
| Alexa Fluor 555 phalloidin |
ThermoFisher |
Cat# A34055 |
| Bacterial and Virus Strains |
| Ad-CMV-CGL (Ad-mCTH) |
Vector Biolabs |
Cat# ADV-256305 |
| Ad-CMV-Null |
Vector Biolabs |
Cat# 1300 |
| Ad-h-VEGFA165 |
Vector Biolabs |
Cat# ADV-227457 |
| Ad-m-ATF4-shRNA |
Vector Biolabs |
Cat# shADV-253208 |
| Ad-GFP |
Vector Biolabs |
Cat# 1060 |
| Biological Samples |
|
|
| Livers (frozen) taken from experimental mouse strains listed in the Experimental Models: Organisms/Strains section |
See Experimental Models: Organisms/Strains section |
See Experimental Models: Organisms/Strains section |
| Serum/Plasma (frozen) taken from experimental mouse strains listed in the Experimental Models: Organisms/Strains section |
See Experimental Models: Organisms/Strains section |
See Experimental Models: Organisms/Strains section |
| Skeletal muscle (frozen) taken from experimental mouse strains listed in the Experimental Models: Organisms/Strains section |
See Experimental Models: Organisms/Strains section |
See Experimental Models: Organisms/Strains section |
| Chemicals, Peptides, and Recombinant Proteins |
| NaHS |
Sigma |
Cat# 161527 |
| GYY4137 |
Sigma |
Cat# SML0100 |
| DL-Propargylglycine |
Sigma |
Cat# P7888 |
| Passive Lysis Buffer (5x) |
Promega |
Cat# E1941 |
| PLP (Pyridoxal 5′-phosphate) |
Sigma |
Cat# P9255 |
| L-cysteine |
Sigma |
Cat# C7352 |
| Lead (II) acetate trihydrate |
Sigma |
Cat# 316512 |
| P3 H2S Detection Probe |
From the lab of Prof. K.H. Ahn |
Singha et al., 2015 |
| SU5146 |
Tocris |
Cat. No. 3037 |
| Ex-527 |
Cayman Chemical |
Cat# 10009798 |
| VECTASHIELD Antifade Mounting Medium with DAPI |
Vector laboratories |
Cat# H-1200 |
| Potassium Cyanide |
Sigma |
Cat# 11813 |
| Phenformin |
Sigma |
Cat# P7045 |
| 2-Deoxy-D-Gucose |
Sigma |
Cat# D8375 |
| Oligomycin A |
Sigma |
Cat# 75351 |
| FCCP (Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone) |
Sigma |
Cat# C2920 |
| Antimycin A |
Sigma |
Cat# A8674 |
| MitomycinC |
Sigma |
Cat# M4287-2MG |
| Compound C (Dorsomorphin) |
Abcam |
Cat# Ab120843
|
| Axitinib |
Selleckchem |
Cat# S1005 |
| L-NAME (hydrochloride) |
Cayman Chemical |
Cat# 80210 |
| Recombinant human VEGF165 |
Peprotech |
Cat# 100-20 |
| Recombinant murine VEGF165 |
Peprotech |
Cat# 450-32 |
| Propidium Iodine |
ThermoFisher Scientific |
Cat# P3566 |
| Annexin V |
ThermoFisher Scientific |
Cat# A13201 |
| Critical Commercial Assays |
| Mouse VEGF ELISA |
Peprotech |
Cat# 900-K99 |
| Mouse VEGF Quantikine ELISA kit |
R&D Systems |
Cat# MMV00 |
| Human VEGF Quantikine ELISA kit |
R&D Systems |
Cat# DVE00 |
| Deposited Data |
|
|
|
| Experimental Models: Cell Lines |
| Primary mouse endothelial cells prepared from C57BL/6, CGL KO, GCN2 KO and SIRT1 inducible KO mice (freshly isolated in the lab of Dr. James Mitchell or Dr. David Sinclair for each experiment) |
Jackson Laboratories and laboratory of Dr. James R. Mitchell |
Cat# 000664; this paper; Das et al. in this issue |
| Primary mouse myotubes from GCN2 WT and KO mice |
From the laboratory of Dr. James R. Mitchell |
This paper |
| Primary CGL WT and KO mouse tail dermal fibroblasts |
From the laboratory of Dr. James R. Mitchell |
This paper |
| Primary mouse hepatocytes from WT mice |
From the laboratory of Dr. James R. Mitchell |
This paper |
| Immortalized MEF |
From the laboratory of Dr. James R. Mitchell |
This paper |
| HUVEC |
Lonza |
Cat# CC-2519 |
| C2C12 |
ATCC |
Cat# CRL-1772 |
| Experimental Models: Organisms/Strains |
| C57BL/6 male and female Mice |
Jackson Laboratories |
Cat# 000664 |
| WT and KO CGL male and female mice on mixed 129/C57BL/6 background |
Strain originally from Dr. Rui Wang and bred in the lab of Dr. James R. Mitchell |
Yang et al., 2008; Hine et al., 2015
|
| GCN2 WT and KO male and female mice |
Strain originally from Dr. David Ron and bred in the lab of Dr. James R. Mitchell |
Munn et al., 2005; Peng et al., 2012
|
| Oligonucleotides |
| si-Scramble (Selective negative control No.1 siRNA) |
ThermoFisher Scientific |
Cat# 4390843 |
| Mouse si-PGC1a (PPARGC1A) |
ThermoFisher Scientific |
Cat# n253420 |
| Mouse si-HIF1a |
ThermoFisher Scientific |
Cat# s67530 |
| Human si-ATF4 |
ThermoFisher Scientific |
Cat# s1704 |
| Human si-PGC1alpha (PPARGC1A) |
ThermoFisher Scientific |
Cat# s21394 |
| Human si-HIF1a (HIFA) |
ThermoFisher Scientific |
Cat# s6539 |
| Human si-eNOS (NOS3) |
ThermoFisher Scientific |
Cat# s9623 |
| human ACTIN/ACTB F: GTTGTCGACGACGAGCG R: GCACAGAGCCTCGCCTT |
N/A |
N/A |
| human ASNS F: GCGGAGTGCTTCAATGTAAC R: CCAATAAGAAAGTGTTCCTGGG |
N/A |
N/A |
| human ATF4 F: CTATACCCAACAGGGCATCC R: GTCCCTCCAACAACAGCAAG |
N/A |
N/A |
|
For a full list of all primers used, please see
Table S1
|
|
|
| Recombinant DNA |
| prK-ATF4 overexpression plasmid |
Addgene |
26114 |
| Software and Algorithms |
| ImageJ |
National Institutes of Health |
https://imagej.nih.gov/ij/download.html |
| GraphPad Prism |
GraphPad |
Version 7.0 |
| FlowJo |
FlowJo LLC |
https://www.flowjo.com/solutions/flowjo |
| Fiji software |
GPL v2, Fiji |
http://fiji.sc/Fiji |
| Matlab R2017A |
MathWorks |
https://www.mathworks.com/programs/trials/trial_request.html?prodcode=ML |
| Other |
|
|
|
|
|
