Skip to main content
. Author manuscript; available in PMC: 2018 Apr 16.
Published in final edited form as: Methods Mol Biol. 2017;1590:165–174. doi: 10.1007/978-1-4939-6921-0_12

Fig. 2.

Fig. 2

Representative image from 3 T7 assays done in parallel. Each sample is from a different gRNA targeted against a mCherry transgene. 3 lanes of each genomic PCR product are run: lanes 2, 5, and 10 are purified genomic PCR product, lanes 3, 6, and 11 are PCR product after hybridization to form heterodimers and in lanes 4, 7, and 12 the heterodimers have been cleaved with T7 endonuclease. Primers: Forward: AAGGGCGAGGAGGATAACATGG; Reverse: TTGTACAGCTCGTCCATGCCG.