Representative image from 3 T7 assays done in parallel. Each sample is
from a different gRNA targeted against a mCherry transgene. 3 lanes of each
genomic PCR product are run: lanes 2, 5, and 10 are purified genomic PCR
product, lanes 3, 6, and 11 are PCR product after hybridization to form
heterodimers and in lanes 4, 7, and 12 the heterodimers have been cleaved with
T7 endonuclease. Primers: Forward: AAGGGCGAGGAGGATAACATGG; Reverse:
TTGTACAGCTCGTCCATGCCG.