Table 1.
Custom TaqMan assays used to confirm the upregulation of LTR12 elements by vorinostat treatment.a
| LTR12 element | Primer and probe set | Designation | Sequence | Length | GC% | Amplicon size (bp) |
|---|---|---|---|---|---|---|
| rv_007357 | Set 1 | Forward (sense) | GAGCGTATGGCGTTATGTAGTT | 22 | 45.5 | 114 |
| Probe (sense) | TTGAGCCGATGAGATCGCTAAGCC | 24 | 54.0 | |||
| Reverse (antisense) | AGCGGTATGTCCTCCCTTTA | 20 | 50.0 | |||
| Set 2 | Forward (sense) | GGAGGAACGAAACACTCATCT | 21 | 47.6 | 102 | |
| Probe (antisense) | TGCAACTTTCACAGAGTCGTCTCACC | 26 | 50.0 | |||
| Reverse (antisense) | CGTCTCACCCACTTCAGAAA | 20 | 50.0 | |||
| rv_007420 | Set 1 | Forward (sense) | GGTAGTGAGAGAGAACGGTATG | 22 | 50.0 | 124 |
| Probe (sense) | TCCTCTGCTCATTCTGGTTGTGCT | 24 | 50.0 | |||
| Reverse (antisense) | CTAAAGAGCTCCCACGGTATAG | 22 | 50.0 | |||
| rv_010177 | Set 1 | Forward (sense) | ACTCCAGACACACCGTCTTA | 20 | 50.0 | 96 |
| Probe (sense) | ATTGGTAGCTTTCCCGAGTCAGCG | 24 | 54.0 | |||
| Reverse (antisense) | TCATTCCATTCAGGTGGGTTC | 21 | 47.6 | |||
aThe “rv” designations from the Human Endogenous Retrovirus Database (HERVd) are listed for each LT12 element. Two primer and probe sets were used for the LTR12 element with designation rv_007357.
GC%, percentage of guanine and cytosine bases in corresponding primer or probe; bp, base pair.