TABLE 2.

MexT oligomerization assayed by bacterial two-hybrid experiments

^aPlasmids pUT18 (ampicillin^r) and pKNT25 (kanamycin^r), for which the tags are at the C termini of the recombinant proteins, were used in this experiment. Full-length alleles of mexT (915 bp) were cloned using primers TH-MexT Fw (CCATGAACCGAAACGACCTGCG) and TH-MexT Rv (AGAGACTGTCCGGATCGCCGA).

^bAverage values were calculated from five independent bacterial cultures, each assayed in triplicates.

^cMH, Mueller-Hinton plates containing 40 μg · ml⁻¹ X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside; revealing cAMP production in blue), 50 μg · ml⁻¹ kanamycin, and 100 μg · ml⁻¹ ampicillin.

^dMC, MacConkey plates containing 1% maltose (revealing cAMP production in red), 50 μg · ml⁻¹ kanamycin, and 100 μg · ml⁻¹ ampicillin.