REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-mouse CD11b, PE-Cy7, Clone M1/70	eBioscience	Cat#25-0112-81
Anti-mouse CD11c, Alexa647, Clone N418	BioLegend	Cat#117312
Anti-mouse CD11c, Alexa700, Clone N418	eBioscience	Cat#56-0114-80
Anti-mouse CD115, PerCP-eFluor710, Clone AF598	eBioscience	Cat#46-1152-82
Anti-mouse CD138, BV605, Clone 281-2	BioLegend	Cat#142516
Anti-mouse CD138, PE, Clone 281-2	BD Biosciences	Cat#553714
Anti-mouse CD162 (PSGL1), Alexa647, Clone 2PH1	BD Biosciences	Cat#562806
Anti-mouse CD185 (CXCR5), Biotin, Clone 2G8	BD Biosciences	Cat#551960
Anti-mouse CD19, FITC, Clone MB119-1	eBioscience	Cat#11-0191-85
Anti-mouse CD19, eFluor450, Clone eBio1D3	eBioscience	Cat#48-0193-82
Anti-mouse CD19, APC-Cy7, Clone 6D5	BioLegend	Cat#115530
Anti-mouse CD19, BV510, Clone 6D5	BioLegend	Cat#115545
Anti-mouse CD192 (CCR2), Alexa647, Clone SA203G11	BioLegend	Cat#150604
Anti-mouse CD197 (CCR7), Biotin, Clone 4B12	eBioscience	Cat#13-1971-82
Anti-mouse CD21/35, APC-eFluor780, Clone eBio8D9	eBioscience	Cat#47-0211-82
Anti-mouse CD23, PE, Clone B3B4	eBioscience	Cat#12-0232-82
Anti-mouse CD24, PerCP-eFluor710, Clone M1/69	eBioscience	Cat#46-0242-82
Anti-mouse CD25, FITC, Clone PC61.5	eBioscience	Cat#53-0251-82
Anti-mouse CD25, APC, Clone PC61	BioLegend	Cat#102012
Anti-mouse CD252 (OX40L), Biotin, Clone RM134L	eBioscience	Cat#13-5905-82
Anti-mouse CD274 (PD-L1), APC, Clone 10F.9G2	BioLegend	Cat#124312
Anti-mouse CD275 (ICOSL), PE, Clone HK5.3	BioLegend	Cat#107405
Anti-mouse CD278 (ICOS), PE-Cy7, Clone C398.4A	BioLegend	Cat#313520
Anti-mouse CD279 (PD-1), PerCP-Cy5.5, clone 29F.1A12	BioLegend	Cat#135208
Anti-mouse CD3e, APC-Cy7, Clone 145-2C11	BioLegend	Cat#100330
Anti-mouse CD4, Alexa700, Clone GK1.5	eBioscience	Cat#56-0041-82
Anti-mouse CD40, PE, Clone IL10	BioLegend	Cat#102806
Anti-mouse CD43, APC, Clone S7	BD Biosciences	Cat#560663
Anti-mouse CD44, eFluor450, Clone IM7	eBioscience	Cat#48-0441-82
Anti-mouse CD45.1 (Ly5.1), PE, clone A20	eBioscience	Cat#12-0453-82
Anti-mouse CD45.1 (Ly5.1), APC, clone A20	eBioscience	Cat#17-0453-82
Anti-mouse CD45.2 (Ly5.2), APC, clone 104	eBioscience	Cat#17-0454-82
Anti-mouse/human CD45R/B220, BV510, clone RA3-6B2	BioLegend	Cat#103247
Anti-mouse CD5, APC, clone 53-73	eBioscience	Cat#17-00051-81
Anti-mouse CD64, APC, clone 54-5/7.1	BioLegend	Cat#139306
Anti-mouse CD80, PerCP-Cy5.5, clone 16.10A1	BioLegend	Cat#104722
Anti-mouse CD86, PE, clone GL-1	BioLegend	Cat#105008
Anti-mouse CD95, PE, clone 15A7	eBioscience	Cat#12-0951-81
Anti-mouse CX3CR1, BV711, clone SA011F11	BioLegend	Cat#149031
Anti-mouse ESAM, PE, clone 1G8/ESAM	BioLegend	Cat#136203
Anti-mouse F4/80, BV421, clone BM8	BioLegend	Cat#123131
Anti-mouse F4/80, APC, clone BM8	eBioscience	Cat#17-4801-82
Anti-mouse/human GL7, Biotin, clone GL7	eBioscience	Cat#13-5902-82
Anti-mouse/human GL7, Alexa647, clone GL7	BD Biosciences	Cat#561529
Anti-mouse I-A/I-E, BV421, clone ME/114.15.2	BioLegend	Cat#107632
Anti-mouse I-A/I-E, PE, clone ME/114.15.3	eBioscience	Cat#12-5321-82
Anti-mouse IgD, APC-Cy7, clone 11-26c2a	BioLegend	Cat#405716
Anti-mouse IgG (1+2a+2b+3), Alexa488	Jackson ImmunoResearch	Cat#115-545-164
Anti-mouse IgG (1+2a+2b+3), PerCP	Jackson ImmunoResearch	Cat#115-125-164
Anti-mouse IgG (1+2a+2b+3)	Jackson ImmunoResearch	Cat#115-005-164
Anti-Goat IgG (H+L), DyLight350	Immunoreagent, INC	RbxGt-003-E35NHSX
Anti-mouse IgM, PE-Cy7, clone R6-60.2	BD Biosciences	Cat#552867
Anti-mouse IL-1β, FITC, clone NJTEN3	eBioscience	Cat#11-7114-82
Anti-mouse Ly6C, FITC, clone AL-21	BD Biosciences	Cat#553104
Anti-mouse T-bet, eFluor660, clone eBio4B10	eBioscience	Cat#50-5825-80
Anti-mouse V⍺2, APC, clone B20.1	BioLegend	Cat#127810
Anti-mouse Vβ5, eFluor450, clone MR9-4	eBioscience	Cat#48-5796-80
Chemicals, Peptides, and Recombinant Proteins
Collagenase D	Roche	Cat#11088882001
DNase I	Roche	Cat#04716728001
Live/Dead fixable Aqua Dead cell stain kit	Invitrogen	Cat#L34957
7-AAD	BD Biosciences	Cat#559925
Streptavidin, PE	eBioscience	Cat#12-4317-82
Streptavidin, APC-Cy7	eBioscience	Cat#47-4317-82
Streptavidin, PerCP-Cy5.5	BD Biosciences	Cat#551419
Recombinant mouse IL-1b	Peprotech	Cat#211-11B
Recombinant mouse IFN-b	R&Dsystems	Cat#12401-1
Diphteria Toxin	emdmillipore	Cat#322326-1MG
Red blood cell lysis buffer	Sigma-Aldrich	Cat#R7757
Thymidine	Sigma-Aldrich	Cat#T9250
Trimethoprim	Sigma-Aldrich	Cat#T7883
Critical Commercial Assays
CD4+ T Cell Isolation Kit, Mouse	Miltenyi Biotec	Cat#130-048-454
Foxp3/Transcription Factor Staining Buffer Set	eBioscience	Cat#00-5523-00
RNeasy Midi Kit	Qiagen	Cat#74144
SuperScript III First-Strand Synthesis System	Invitrogen	Cat#18080-051
Trizol LS Reagen	Thermo Fisher	Cat#10296028
Brefeldin A	Sigma	Cat#B7651-5MG
SBA Clonotyping System C57BL/6-HRP	SouthernBiotech	Cat#5300-05B
Maxima SYBR Green/ROX qPCR Master Mix (2X)	Thermo Fisher	Cat#K0222
Deposited Data
Experimental Models: Organisms/Strains
Mouse: C57BL/6J	Jackson Laboratory	Cat#000664
Mouse: muMT−/−	Jackson Laboratory	Cat#002249
Mouse: Zbtb46-DTR	Jackson Laboratory	Cat#019506
Mouse: Il1r1−/−	Jackson Laboratory	Cat#003245
Mouse: CD45.1	Jackson Laboratory	Cat#002014
Mouse: CD11c-DTR	Jackson Laboratory	Cat#004509
Mouse: MyD88−/−	From Drs. Akira and Medzhitov
Mouse: Trif−/−	From Drs. Akira and Medzhitov
Mouse: OT-II	From Drs. Akira and Medzhitov
Mouse: Casp1−/− Casp11129mt/129mt	From Dr. Flavell
Mouse: Ifnar1−/−	From Dr. Lopez
Mouse: Irf3−/−	From Dr. Lopez
Mouse: CCR2-CFP-DTR	From Dr. Pamer Lab (Hohl et al., 2009)
Mouse: CX3CR1-STOP-DTR/CD11c-CRE	From Dr. Iliev Lab (Diehl et al., 2013)
Oligonucleotides
Mouse Actb forward primer for qRT-PCR: GAAGTCCCTCACCCTCCCAA	This paper	N/A
Mouse Actb reverse primer for qRT-PCR: GGCATGGACGCGACCA	This paper	N/A
Mouse Il21forward primer for qRT-PCR: GCTCCACAAGATGTAAAGGGGC	This paper	N/A
Mouse Il21 reverse primer for qRT-PCR: CCACGAGGTCAATGATGAATGTC	This paper	N/A
Mouse Bcl6 promoter forward primer for qRT-PCR: CCTGTGAAATCTGTGGCACTCG	This paper	N/A
Mouse Bcl6 promoter forward primer for qRT-PCR: CGCAGTTGGCTTTTGTGACG	This paper	N/A
Mouse Tbx21 promoter forward primer for qRT-PCR: ACCAACAACAAGGGGGCTTC	This paper	N/A
Mouse Tbx21 promoter forward primer for qRT-PCR: CTCTGGCTCTCCATCATTCACC	This paper	N/A
Recombinant DNA
Software and Algorithms
GraphPad Prism 5	GraphPad Software	N/A
FlowJo 8.7	Tree Star	https://www.flowjo.com/solutions/flowjo/downloads
Image J 2.0.0-rc-43/1.51s	NIH Image	https://imagej.net/
Other