Table 2.
Primers and probes designed for real-time PCR detection of M. ulcerans by targeting IS2404, IS2606, and KR-B gene.
| Target sequence | Prime or Probe | N° of bases | Amplicon size | Sequences (5′–3′) | Nucleotide positions | No. of copies of amplicon per plasmid/chromosome |
|---|---|---|---|---|---|---|
| IS2404 | IS2404 TF | 19 | 59 | AAAGCACCACGCAGCATCT | 27746–27762 | 4/201 |
| IS2404 | IS2404 TR | 18 | AGCGACCCCAGTGGATTG | 27787–27804 | ||
| IS2404 | IS2404 TP | 6FAM-CGTCCAACGCGATC-MGBNFQ | 27768–27781 | |||
| IS2606 | IS2606 TF | 21 | 58 | CCGTCACAGACCAGGAAGAAG | 28912–28932 | 8/82 |
| IS2606 | IS2606 TR | 21 | TGCTGACGGAGTTGAAAAACC | 28947–28969 | ||
| IS2606 | IS2606 TP | VIC-TGTCGGCCACGCCG-MGBNFQ | 28933–28946 | |||
| KRB | KR-BTF | 18 | 65 | TCACGGCCTGCGATATCA | 3178–3195 | 15/0 |
| KR-B | KR-BTR | 21 | TTGTGTGGGCACTGAATTGAC | 3222–3242 | ||
| KR-B | KR-BTP | 6FAM-ACCCCGAAGCACTG-MGBNFQ | 3199–3212 |