Table 1.
Primers for full length HBsAg amplification and their nucleotide position.
| Primer code | Primer sequence | Primer length | Nucleotide position |
|---|---|---|---|
| SBFO10 | 5′ GGGTCACCATATTCTTGG 3′ | 19 | 2859–2878 |
| SBRO20 | 5′ CCCACCTTAGAGTCCAAGG 3′ | 19 | 873–892 |
| SBFI30 | 5′ GAACAAGAGCTACCGCATGGG 3′ | 21 | 2877–2898 |
| SBRI40 | 5′ CAAGAGACAAAAGAAAATTGG 3′ | 21 | 810–789 |
Nucleotide positions are based on the HBV reference sequence (contained in 3221 bp) that was retrieved from DDBJ/EMBL/GenBank.