Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer used in RT-PCR.
| Gene | Forward primer | Reverse primer | Product size (bp) |
|---|---|---|---|
| mTORC1 | agaggaccagcagcacaagcagga | tggtggcagtggtggtggcatt | 299 |
| AgRP | agacagcagcagaccgagcagaaga | gccagtacctagcttgcggcagtag | 218 |
| NPY | cgtgtgtttgggcattctggctgag | tggtgggacaggcagactggtttca | 325 |
| PoMC | tgatggcttggagcacgtcctggag | gcgtctggctcttctcggaggtcat | 137 |
| β-Actin | gaagatcaagatcattgctcct | tactcctgcttgctgatcca | 111 |
