Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
BsaI DNA cassette is highlighted in red letters. BamHI and Bsu36I cutting sites are italicized. Nucleotides are colored according to Figure. OL is short for ‘over-lapping’.
|
Barn H I-THSD1-F: GGTggatccACCatgaaaccaatgttgaaagac |
|
Bsal-0L-R tggctctctcaagagaagatattcAGAGACCAGAGGTCTCA gcttctccaagaacatag |
|
Bsal-0L-F ctatgttcttggaga a gctTGAGACCTCTGGTCTCTga atatcttctcttgagagagcca |
|
Bsu361-THSD1-R: cttcttgcctcaggaagactgtt |
