Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer information for PCR verification in miRNAs.
| miRNAs | Primers sequence (5′-3′) |
|---|---|
| U6 Forward | ctcgcttcggcagcaca |
| U6 Reverse | aacgcttcacgaatttgcgt |
| miR-144-3p | ggttttttttggggtacagtatagatga |
| miR-99a-3p | tgggtttcaagctcgtttctatg |
| miR-200c-3p | gtgggtaatactgccgggta |
| miR-200b-3p | ttggtttttgtaatactgcctggtaat |
