Table 2. Name and characterization of siRNAs used.
| Targeted Gene(s) | siRNA and sense sequence(5’-3’) | Manufacturer | Description (http://www.ncbi.nlm.nih.gov/) |
References |
|---|---|---|---|---|
| Allstars | Allstars Negative Control siRNA sequence proprietary |
Qiagen® | Negative control, non-targeting siRNA no homology to any mammalian gene |
|
| NP | siNP CUCCGAAGAAAUAAGAUCCTT |
Ambion®/Life Technologies™ | Positive control, degrades virion RNA and mRNA | Ge (2003) |
| COPA | Hs_COPA_3 CTGGCGCATGAATGAATCAAA |
Qiagen® | Coatomer protein complex, subunit alpha, endosomal transport | Karlas (2010) Konig (2010) Brass (2009) Shapira (2009) |
| ATP6AP1 | Hs_ATP6AP1_7 CAGCAATGGCTCCGTCGCCTA |
Qiagen® | Proton-transporting V-type ATPase, acidification of endosome | Karlas (2010) Konig (2010) Brass (2009) Hao (2008) |
| NXF1 | s20532 Silencer® Select CGAACGAUUUCCCAAGUUAtt |
Ambion®/Life Technologies™ | nuclear RNA export factor 1 Nuclear export of viral mRNA, RNP |
Karlas (2010) Brass (2009) Shapira (2009) Hao (2008) |
| ARCN1 | s1541 Silencer® Select GAGAGACUCAAGAACGUGAtt |
Ambion®/Life Technologies™ | Coatomer protein complex, subunit delta, endosomal transport | Karlas (2010) Konig (2010) Brass (2009) Hao (2008) |
| PGD | s224256 Silencer® Select GUUUGAUGGUGAUAAGAAAtt |
Ambion®/Life Technologies™ | many processes including microtubule transport, cytoskeleton dependent intracellular transport | Brass(2009) Shapira(2009) Hao (2008) |
| RPS14 | s226969 Silencer® Select CAAGAUUCCUCAAAAUAUUtt |
Ambion®/Life Technologies™ | ribosomal protein S14, initiation of translation | Karlas (2010) Hao (2008) |
| NUP98 | s9783 Silencer® Select GGAUUGUUUGGAACCAGUUtt |
Ambion®/Life Technologies™ | Nuclear pore complex protein, nuclear import and export | Karlas (2010) Brass (2009) Hao (2008) |
| COMBO1 | COPA/ARCN1/NUP98/ATP6AP1/RPS14 | See component siRNAs | ||
| COMBO2 | NXF1/COPA/ATP6AP1/RPS14 | See component siRNAs | ||
| COMBO3 | NXF1/ATP6AP1/RPS14 | See component siRNAs | ||
| COMBO4 | ATP6AP1/PGD/RPS14/NUP98 | See component siRNAs | ||
| COMBO5 | ATP6AP1/PGD/NUP98 | See component siRNAs | ||
| HsDeath | Allstars Hs Cell Death Control siRNA sequence proprietary |
Qiagen® | siRNAs targeting human genes needed for cell survival |