Table 1.

PCR primers and reaction conditions used for the detection of genes implicated in virulence of enterococcal isolates.

Virulence determinant genes	Primer sequence (5′-3′)	Amplicon (bp)	Annealing temperature (°C)	Reference
agg (aggregation substance)	F:AAGAAAAAGAAGTAGACCAAC R:AAACGGCAAGACAAGTAAATA	1553	50	Eaton and Gasson, 2001
esp (Enterococcal surface protein)	F:AGATTTCATCTTTGATTCTTGG R:AATTGATTCTTTAGCATCTGG	510	48	Vankerckhoven et al., 2004
gel E (extracellular metallo-endopeptidase)	F:ACCCCGTATCATTGGTTT R: ACGCATTGCTTTTCCATC	419	51	Sabia et al., 2008
cyl (cytolysin)	F: ACTCGGGGATTGATAGGC R: GCTGCTAAAGCTGCGCTT	688	58	Vankerckhoven et al., 2004