Skip to main content
Molecular Biology of the Cell logoLink to Molecular Biology of the Cell
. 2001 Sep;12(9):2567–2577. doi: 10.1091/mbc.12.9.2567

ASH1 mRNA Localization in Three ActsV⃞

Dale L Beach 1,*, Kerry Bloom 1
Editor: Douglas Koshland1
PMCID: PMC59695  PMID: 11553699

Abstract

Novel green fluorescent protein (GFP) labeling techniques targeting specific mRNA transcripts reveal discrete phases of mRNA localization in yeast: packaging, transport, and docking. In budding yeast, ASH1 mRNA is translocated via actin and myosin to the tip of growing cells. A GFP-decorated reporter transcript containing the ASH1 3′ untranslated region gRNAASH1 forms spots of fluorescence localized to a cortical domain at the bud tip, relocates to the mother-bud neck before cell separation, and finally migrates to the incipient bud site before the next budding cycle. The correct positioning of the mRNA requires at least six proteins: She1p-5p and Bud6p/Aip3p. gRNAASH1 localization in mutant strains identified three functional categories for the She proteins: mRNA particle formation (She2p and She4p), mRNA transport into the bud (She1p/Myo4p and She3p), and mRNA tethering at the bud tip (She5p/Bni1p and Bud6p/Aip3p). Because localization of the mRNA within the bud does not a priori restrict the translated protein, we examine the distribution of a mother-specific protein (Yta6p) translated from a mRNA directed into the bud. Yta6p remains associated with the mother cortex despite localization of the mRNA to the bud. This video essay traces the life history of a localized mRNA transcript, describes the roles of proteins required to polarize and anchor the mRNA, and demonstrates at least one instance where mRNA localization does not effect protein localization.

INTRODUCTION

Since the first description of asymmetrically distributed actin mRNA in ascidian embryos (Jeffrey et al., 1983), localized transcripts have been identified in organisms from mice to men, frogs to flies, and most recently plants and fungus. The classic examples of localized messages primarily include embryonic polarity determinants: oskar, bicoid, nanos, and other mRNAs strategically positioned to define the primary axes of the Drosophila oocyte; Vg1 and other messages enriched in the vegetal hemisphere of the frog oocyte; and actin and myelin basic protein messages transported to specialized regions of highly polarized cells (St. Johnston, 1995). Most recently, ASH1 mRNA localization to the bud tip in yeast (Long et al., 1997; Takizawa et al., 1997) and differential segregation of expansin mRNAs to apical and basipetal ends of xylem precursor cells (Im et al., 2000) demonstrate that fungi and plants also asymmetrically distribute specific mRNA transcripts.

Live cell imaging of mRNA dynamics provides the opportunity to examine transport (path and rate) as well as anchorage (site and range) of mRNA in real time. Green fluorescent protein (GFP) labeling of nucleic acids is mediated through site-specific DNA or RNA binding proteins. The Escherichia coli transcriptional regulatory elements for the lactose operon (lacI and lacO) and the tetracycline operon (tetR and tetO) have been used as markers for chromosomal movements (Robinett et al., 1996; Michaelis et al., 1997). In parallel to DNA binding proteins, GFP fusions with site-specific RNA binding proteins are being used to visualize and track mRNA in living cells. Three investigators have independently constructed systems for the in vivo imaging of mRNA in live yeast cells. Two systems use the RNA binding coat protein (CP) of the bacteriophage MS2 (Bertrand et al., 1998; Beach et al., 1999) and a third uses the U1A splicing protein (Takizawa and Vale, 2000). Additionally, the MS2 coat protein-based system has been successfully applied to mammalian cells to image mRNA transport in living neurons (Rook et al., 2000).

The localization of ASH1 mRNA in budding yeast has provided an informative model system for mRNA transport and anchorage, combining live cell imaging, biochemistry, and genetics. Ash1p is a transcription factor that is segregated to the daughter cell nucleus providing an asymmetric cell fate determinant. The ability of haploid yeast cells to change mating types (a to α and/or α to a) is observed in mother cells; new daughter cells rarely switch mating type. Ash1p inhibits mating type switching in daughter cells by blocking HO endonuclease transcription (Bobola et al., 1996; Maxon and Herskowitz, 2001; Sil and Herskowitz, 1996). Cleavage of the HO endonuclease site at the mating type locus initiates mating type switching. A separate activity of Ash1p is required for cells to enter unipolar (pseudohyphal) growth (Chandarlapaty and Errede, 1998). Ash1p asymmetry requires a set of proteins originally identified as regulators of HO endonuclease expression (Bobola et al., 1996; Jansen et al., 1996; Sil and Herskowitz, 1996). SHE1-SHE5 (for Swi5-dependent HO expression) regulates HO production, ultimately through the localization of the ASH1 mRNA.

Daughter-specific inheritance of Ash1p is maintained by localizing the ASH1 mRNA to the bud. Domains within the coding region and the 3′ untranslated region (UTR) of the ASH1 mRNA encode signal sequences directing mRNA transport and anchorage within the bud (Chartrand et al., 1999; Gonzalez et al., 1999). Functional analyses of the she mutants have defined the steps in mRNA localization. In the absence of an individual She protein, the ASH1 mRNA remains within the mother cell (she1/myo4), relocalizes to the neck (she5/bni1), or is distributed between the mother and the bud (she2, she3, she4).

Diffusion of proteins or mRNA from the bud into the mother may be inhibited at the neck via a barrier maintaining asymmetries between mother and bud. A genomic DNA array screen probing for additional transcripts associated with the She proteins (She1p/Myo4p, She2p, She3p) identified several genes, including IST2 (Takizawa et al., 2000). The IST2 mRNA is localized in a SHE1-5-dependent manner, similar to the ASH1 transcript, and Ist2p is predicted to be an integral membrane protein, restricted to the bud cortex by a septin-dependent barrier at the mother-bud neck (Takizawa et al., 2000). The septin barrier restricts several proteins, including Spa2, Myo2p, Sec3p, and Sec5p to the bud and maintains actin patch asymmetry (Barral et al., 2000). The presence of a septin-dependent barrier at the mother-bud neck delineates mother and bud cortical regions by maintaining the distribution of proteins between compartments. Potentially, such a barrier at the neck could inhibit the flow of both cortical and cytoplasmic factors, including proteins and mRNA.

The power of yeast genetics, combined with recent advances in multimode fluorescence microscopy, facilitates the dissection of the mRNA localization pathway. Once exported from the nucleus, ASH1 mRNA transcripts coalesce into particles. Assembled particles are transported from the mother into the bud via actin cables, and once in the bud, the mRNA is constrained to the bud tip. We present a series of time-lapse sequences with this article to document aspects of mRNA dynamics in live cells.

MATERIALS AND METHODS

Growth Media and Yeast Strains

Wild-type cells were grown in YPD (2% glucose, 1% yeast extract, 2% peptone). Cells transformed with plasmids were grown on selective synthetic glucose based media (SD: 0.67% yeast nitrogen base, 2% glucose) lacking uracil, histidine, or both. To induce CP-GFP, CP/FG-GFP, GFP-Yta6, or GFP-Yta6-ASH1 production from pCP-GFP, pCP/FG-GFP, pGFP-YTA6, or pDB100, respectively, cells were switched to SD-MET for 1–2 h.

The strains used in these studies are listed in Table 1. Gene deletions were constructed by polymerase chain reaction (PCR) fragment-mediated transformation to replace the coding region of the target gene with a selectable marker as noted in Table 1 (Wach et al., 1994). Deletions were verified by PCR with the use of primers flanking the coding region. Deletion and verification primer sequences are available upon request.

Table 1.

Yeast strains used in this work

Strain Genotype Reference
YEF473A MATa trp-Δ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1 Bi et al. (1998)
JZY1345 MATα trp1-Δ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1, bud6Δ∷TRP1 Amberg et al. (1997)
KBY1011 MATa trp-Δ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1, bni1Δ∷LEU2 Beach et al. (1999)
KBY1012 MATα, lys2, his3, ura3-52, leu2, myo4∷ura3-52, bens Beach et al. (1999)
KBY1018 MATa trp-Δ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1, she2Δ∷HPH This study
KBY1019 MATa trp-Δ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1, she4Δ∷HPH This study
KBY1020 MATa trp-Δ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1, she4Δ∷HIS3, she2Δ∷HPH This study
KBY1021 MATa trpΔ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1, she4Δ∷HIS3 This study
KBY1027 MATa trp-Δ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1, yta6Δ∷KAN This study
KBY1046 MATa trp-Δ63, leu2Δ1, ura3-52, his3Δ200, lys2-8Δ1, bni1Δ∷LEU2, bud6Δ∷TRP1 This study

For live-cell imaging, cells were transferred onto growth chambers mounted on glass slides. Chambers were constructed as described in Shaw et al. (1997) with the use of SD-COMPLETE (synthetic dextrose media with a complete complement of nutritional supplements) or SD-MET (used to maintain induction from plasmids as listed above) supplemented with 0.25% gelatin (catalog no. G-2500; Sigma, St. Louis, MO). Mid-log phase cultures (OD660 = ∼0.4–0.8) were concentrated ∼20–50-fold before cells were added to the growth chamber. To arrest and maintain cells with large buds, cells were treated with 100 μM nocodazole to inhibit mitosis. Cells were arrested for 4 h before the induction of GFP-YTA6-ASH1. Because the ASH1 mRNA localization is microtubule-independent, it is not affected by nocodazole treatments (Long et al., 1997; Takizawa et al., 1997).

To determine the frequency of green RNA (gRNA) spots within cell populations we observed cells of different genotypes (Table 2) coexpressing pIIIA/ASH1-UTR and pCP/FG-GFP. Cells grown to mid-log phase (OD660 = ∼0.4–0.8) in SD-URA-HIS were washed in SD-MET, resuspended in 2 volumes of SD-MET, and incubated for 1 h at 30°C to induce production of the MS2-CP/FG-GFP fusion protein before observation. Cells were placed onto microscope slides pretreated with 0.1% poly-l-lysine to minimize movements during observations. The proportion of cells containing fluorescent spots within the population was determined by direct observation.

Table 2.

Spot formation frequencies The proportion of cells containing one or more gRNA spots is shown for different strains defective in spot aggregation.

Strain Spot Frequency (%) n
YEF473A gRNA-FG (WT) 9.7  ± 2.1 995
KBY1018 gRNA-FG (she2) 3.5  ± 0.7 962
KBY1019 gRNA-FG (she4) 10.7  ± 3.2 1010
KBY1020 gRNA-FG (she2, she4) 3.7  ± 0.6 533
YEF473A pCP/FG-GFP 0.4  ± 0.2 917

WT, wild type. 

To determine whether the MS2 binding site (AAACATGAGGATTACCCATGT) is present within the Saccharomyces cerevisiae genome, the nucleotide sequence of the MS2 sites was submitted to a Blast search of the entire yeast chromosomal genome with the use of default settings (http://genome-www2.stanford.edu/cgi-bin/SGD/nph-blast2sgd). No hits were reported from a search completed January 25, 2001 (database posted September 13, 2000).

Plasmid Construction

The gRNA labeling system uses the plasmids pCP-GFP, containing a fusion between the MS2 coat protein and GFP, and a pIIIA/MS2-1-derived plasmid (SenGupta et al., 1996) containing the ASH1 3′ UTR. gRNAASH1 imaging required plasmids pCP-GFP and pIIIA/ASH1-UTR (Beach et al., 1999). gRNAKAR9 imaging required pCP-GFP and pIIIA/K9UTR (Beach et al., 1999). The plasmid pGFP-YTA6 is a generous gift of Don Katcoff (Bar Illam University, Ramat Gan, Israel), and includes an expression cassette for the green fluorescent protein fused to the amino terminus of the full-length YTA6 coding region expressed from the MET25 promoter.

The plasmid pCP/FG-GFP was constructed in a similar manner to pCP-GFP (Beach et al., 1999). Briefly, the MS2 coat protein dlFG allele (Peabody and Ely, 1992) was amplified from pCT14-MS2-GFP (Bertrand et al., 1998) via PCR and ligated into the BamHI-XbaI sites of pUG23. The dlFG allele of the MS2 coat protein is deleted for the FG loop required for oligomerization of the protein and viral capsid formation (Peabody and Ely, 1992). Cells coexpressing CP-GFP and the MS2-ASH1 3′ UTR transcript were indistinguishable from cells coexpressing CP/FG-GFP and the MS2-ASH1 3′ UTR transcript (our unpublished results).

To construct pDB100, a PCR fragment containing the MS2 binding sites and E3 portion (Chartrand et al., 1999) of the ASH1 3′ UTR from pIIIA/ASH1-UTR was generated. The fragment was cut with EcoRI at a site adjacent to the MS2 coat protein target sequence, which was filled in via Klenow polymerase to form a blunt end, and HindIII at a site incorporated into the downstream primer. The cut fragment was ligated into pGFP-YTA6 cut within the polylinker region downstream of the YTA6 coding region at SmaI and HindIII sites to create the plasmid pDB100. pDB100 therefore contains an expression cassette for the GFP-YTA6-ASH1/E3 fusion construct regulated by the MET25 promoter.

Microscopy and Image Processing

Microscopy and digital imaging, including optical sectioning, was performed as described in Shaw et al. (1997). Five optical sections, images taken at different focal planes ranging through the cell, were taken at 0.75-μm increments through the cell for a total of 3.0 μm/time point. The central optical section, including both a transmitted light and an epifluorescent (GFP) image was focused at the cell neck. Images were captured with the use of a Hamamatsu Orca II (model C4742-98) charge-coupled device camera mounted on a Nikon Eclipse E600FN with the use of 100× 1.4 NA Plan Apochromat objective with 1× magnification to the camera. The Metamorph software package (Universal Imaging, Downington, PA) for the Windows operating system was used for microscope automation, image acquisition, and image analysis. Images for publication were manipulated for scaling, size, resolution, and arrangement with Windows versions of Photoshop (Adobe Systems, Mountain View, CA) and Corel Draw (Corel, Ottawa, ON, Canada). Composite images of cells were generated with the use of the “3D Reconstruction” function of Metamorph set for a single plane construction with the use of the brightest elements from each image.

gRNAASH1 velocity measurements were obtained measuring the point-to-point movements of the gRNAASH1 spots. The distance of spot movements at 1-min intervals provided instantaneous velocities representing a minimal speed at each time point, and averaged over time. Only movements between sequential images were considered for velocity measurements. Because the spots frequently change direction between long time points, continuous velocities could not be measured.

RESULTS AND DISCUSSION

In Vivo mRNA Labeling

To construct an in vivo labeling system for mRNA, we used the site-specific RNA binding coat protein of the bacteriophage MS2. MS2 is a + strand RNA bacteriophage infecting F+ Escherichia coli by binding the pili, rod-like extensions from the cell body. Late in the infection cycle, the coat protein binds MS2 genomic RNA preventing translation of the Replicase and coat protein genes, while allowing translation of the Lysis gene. These events precede complete encapsulation of the MS2 RNA genome by the coat protein, and lysis of the bacterial cell (Brock et al., 1994). The MS2 binding site is a 23-bp sequence (5′-AAACAUGAGGAUUACCCAUGU-3′) that forms a stem loop structure bound by a homodimer of the coat protein (Peabody, 1990). Placement of the binding site adjacent to a start codon is sufficient to block translation initiation in both bacteria (Peabody, 1990) and budding yeast (Stripecke et al., 1994) when bound by the coat protein. The MS2 coat protein binding site is absent from the S. cerevisiae genome (see MATERIALS AND METHODS), making integrated binding sites unique such that the MS2 coat protein recognizes only recombinant mRNA transcripts containing the MS2 coat protein binding site. The mRNA labeling system consists of two components (Figure 1): a recombinant RNA transcript, including “Your Favorite Gene” with two tandem MS2 binding sites, and a fusion protein combining the MS2 coat protein and the green fluorescent protein (Beach et al., 1999).

Figure 1.

Figure 1

RNA labeling system. The RNA labeling system is comprised of two components: a site-specific RNA binding protein fused to GFP and an mRNA transcript containing the target sequence for the RNA binding protein. This system uses the MS2 coat protein and the associated RNA binding site. A mRNA transcript including “Your Favorite Gene” (YFG) and the MS2 coat protein binding site is fluorescently labeled when coexpressed with the MS2 coat protein fused to GFP. Localized transcripts can be visualized by standard fluorescence microscopy.

The 3′ UTR of the ASH1 mRNA encodes signal sequences sufficient for mRNA transport and anchorage within the bud. Unlike other localized mRNAs, the coding region of the ASH1 message also includes targeting sequences capable of localizing the mRNA (Chartrand et al., 1999; Gonzalez et al., 1999). Our studies use a reporter construct, including two tandem repeats of the MS2 binding sites and the entire ASH1 3′ UTR (Beach et al., 1999). Expression of the MS2-ASH1 3′ UTR fusion from a constitutively active promoter (RNA polymerase III-specific) allows the visualization of a localized reporter transcript throughout the cell cycle.

The MS2 coat protein fusion with GFP (CP-GFP) produces a fluorescent protein targeted to the recombinant transcript (Figure 1). Expression of CP-GFP alone results in a diffuse distribution of GFP fluorescence throughout the cytoplasm (Beach et al., 1999). Attenuation of the CP-GFP fusion protein production via a regulated promoter (the MET25 promoter) reduces background fluorescence within the cell. Coexpression of the MS2-ASH1 3′ UTR transcript with CP-GFP results in spots of GFP fluorescence localized to the bud tip (Figures 1 and 2). Termed gRNA, these gRNAASH1 spots localize as predicted from in situ labeling of ASH1 mRNA in fixed cells (Long et al., 1997; Takizawa et al., 1997).

Figure 2.

Figure 2

gRNAASH1 localization in vegetative, haploid cells. gRNAASH1 localization is dynamic, changing as the cell proceeds through the cell cycle. In small- (a) to large (b)-sized buds the gRNAASH1 is localized to the bud tip, moving on the cortex within a region at the bud tip termed the cortical bud cap. (c) gRNAASH1 migrates to the neck of large budded cells 25 min before cell separation. (d) After cell separation, the gRNAASH1 remains at the old bud site in both the mother and the bud. (e) Approximately 10 min before bud emergence (arrow) the gRNAASH1 moves to the incipient bud site then remains at the bud tip during early growth. Numbers in the upper right corner in each frame represent an elapsed time corresponding with video sequence 1. Bar, 5 μm.

gRNA Localization in Wild-Type Cells

gRNAASH1 spots are clearly visible at the bud tip during bud growth (Figure 2, a and b), and gRNAASH1 spots are motile within a small domain at the bud tip in time-lapsed images of the cells (video sequence 1). Sequential images taken through the cell at 0.75-μm intervals indicate that the gRNAASH1 spots remain associated with the cell cortex and spots remain within ∼0.3 μm of the bud tip. Spot movements within this region appear to be random because gRNAASH1 spots frequently move only short distances before changing direction, even when imaged at three frames per second (our unpublished results). The average movement rate of the spot at the bud tip is 0.3 μm/min (n = 10) (Beach et al., 1999).

Late in the cell cycle, after cessation of bud growth and before cell separation, the gRNAASH1 relocalizes to the mother-bud neck. Migration of the gRNAASH1 toward the bud neck occurs 25 ± 5 min (n = 6) before cell separation (compare Figure 2, b and c; video sequence 1) and is more rapid than restricted movement at the bud tip, with velocities averaging ∼1 μm/min (n = 4). gRNAASH1 at the neck remains motile, forming a single spot between the mother and bud domains. In a subset of cells, gRNAASH1 at the neck divides into independent spots in the mother and the bud (see video sequence 1). Spot separation precedes cell separation by ∼10–15 min and correlates temporally with the completion of cytokinesis (Bi et al., 1998). gRNAASH1 is then positioned at the incipient bud site for the ensuing cell cycle (Figure 2d; video sequence 1).

When presented with mating pheromones from cells of opposite mating type, yeast enter a period of highly polarized growth resulting in the formation of a mating projection or shmoo. Entry into the mating cycle and growth of the mating projection is another example of polarized growth in budding yeast. gRNAASH1 is localized at the tip of the mating projection before cell-cell contact, and remains at the isthmus between the cells after they fuse (Figure 3a, video sequence 2). One or more gRNAASH1 spots remain within proximity of the site of cell fusion, and retain motility, moving back and forth within the isthmus between the cells. gRNAASH1 localizes exclusively to the incipient bud site (compare Figure 3, a and b) ∼20 min before emergence of the first diploid bud (Figure 3c).

Figure 3.

Figure 3

gRNAASH1 localization in mating cells. gRNAASH1 localizes to regions of polarized growth throughout the mating cycle. The two cells centered in the frame (MATa with gRNAASH1 is left, top and MATα is right, bottom) proceed through mating and generate a diploid bud. (a) Before cell fusion, the gRNAASH1 is at the mating projection tip nearest the cell of opposite mating type. The GFP signal in the left, top (MATa) cell is elevated compared with levels in the bottom, right cell (MATα). (b) After cell fusion and before bud emergence, the gRNAASH1 spot is localized at the incipient bud site (compare b and c). (c) gRNAASH1 is at the tip of the first diploid bud. Numbers in the upper right corner of each frame represent an elapsed time corresponding with video sequence 3. Bar, 5 μm.

The cell cycle-dependent localization of ASH1 mRNA is similar to the transient localization of a number of polarity determinants (Pringle et al., 1995), including Bni1p and Bud6p. Both proteins act to establish cell polarity through the actin cytoskeleton as well as to maintain ASH1 mRNA localization (see below). Bni1p is localized to the site of cellular growth in the bud and returns to the neck before cell separation (Ozaki-Kuroda et al., 2001). In contrast, Bud6p is distributed as punctate spots throughout the bud cortex, enriched at the bud tip and neck during cell growth, and forms two rings on mother and bud sides of the neck before cell division (Amberg et al., 1997; Beach et al., 1999; Segal et al., 2000). Results from both vegetative and mating cells demonstrate that the ASH1 mRNA is directed to sites of polarized growth.

Changes in the polarity of the actin cytoskeleton are mirrored in ASH1 mRNA localization. Actin filaments reorient toward the neck concomitant with the completion of mitosis (Adams and Pringle, 1984), potentially in concert with the migration of Bni1p and Bud6p to the neck. Initially polarized toward the incipient bud site, the actin cytoskeleton remains polarized toward the bud tip through anaphase onset then reorients toward the neck before cytokinesis (Adams and Pringle, 1984), as observed for ASH1 mRNA. The repositioning of anchored mRNA could be facilitated by transport along repolarized actin filaments, repositioned along with the cortical anchors She5p/Bni1p and Bud6p/Aip3p, or both.

she Mutants: Particle Formation

The initial step for mRNA localization is the packaging of transcripts into transport particles (Ainger et al., 1993; Ferrandon et al., 1994; Theurkauf and Hazelrigg, 1998; Wilhelm et al., 2000). Although gRNAASH1 forms particles in wild-type strains, we observed a decrease in the number of cells containing gRNAASH1 spots in a she2 mutant strain (Table 2; Bertrand et al., 1998) and incomplete particle aggregation in both she2 and she4 cells (Figure 4). To be certain that spots observed in these strains were due to ASH1 mRNA aggregation and not MS2 coat protein multimers, we detected the reporter transcript with the use of a modified coat protein (pCP/FG-GFP; see MATERIALS AND METHODS). A deletion of the FG loop in the dlFG allele of the MS2 coat protein inhibits protein-protein interactions required for oligomerization of the coat protein and viral capsid formation (Peabody and Ely, 1992). Expression of CP/FG-GFP in the absence of the reporter transcript produced fluorescent spots in <1% of the cells (Table 2, YEF473 pCP/FG-GFP). gRNAASH1 spots are observed in ∼3.5% of she2 cells, one-third fewer than an isogenic wild-type strain (Table 2). In a she4 strain, cells containing gRNAASH1 spots are observed at frequencies similar to wild type (Table 2), whereas the frequency of cells containing fluorescent spots in the double mutant she2 she4 are reduced to the value of the she2 single mutant (Table 2).

Figure 4.

Figure 4

She2p and She4p are required for gRNAASH1 spot assembly. gRNAASH1 localization in she2Δ (a–c, g, and h), and she4Δ (d-f, i, and j) cells. (a–c) gRNAASH1 aggregates into spots in both the mother and the bud in she2Δ cells. A single she2Δ cell is shown imaged via DIC (a) and GFP fluorescence (b). The composite image (c) represents 20 consecutive time points at a 1-min interval to illustrate dynamic spot movements not apparent within single images (video sequence 3). (d–f) Several spots distributed between mother and but were also observed in she4Δ cells. A single she4Δ cell is shown imaged via Nomarski (a) and GFP fluorescence (b). The composite image (c) represents 20 consecutive time points at a 1-min interval to illustrate dynamic spot movements not apparent within single images (video sequence 4). Bar, 5 μm.

In she2 and she4 mutant cells containing gRNAASH1 spots, multiple spots are observed, whereas wild-type cells maintain only one to two localized spots. Of time-lapsed cells, 67% of she2 (n = 10) and 72% of she4 (n = 18) cells contained three or more spots distributed between mother and bud (Figure 4, b and e; video sequences 3 and 4). The number of spots varied between cells, and a maximum of six independent, motile spots was observed in a single she4 cell. Inspection of individual optical sections (see MATERIALS AND METHODS) reveals that the gRNAASH1 spots in either strain are not associated with the cell cortex. Spots observed in she2Δ and she4Δ cells were motile with average velocities of 0.93 ± 0.56 μm/min (n = 3) and 0.61 +/- 0.19 μm/min (n = 4), respectively. These rates are similar to ASH1 mRNA in other she mutants (see below) and two- to threefold faster than spots at the bud tip in wild-type cells. To illustrate the distribution and movements of gRNAASH1 spots in she2 and she4 cells, multiple frames from each time lapse are combined to form the composite images shown in Figure 4, c and f. These images represent 15 consecutive images captured at 1-min intervals to demonstrate spot dynamics in a single image. The formation of multiple spots illustrates a loss of efficient ASH1 mRNA packaging in the absence of She2p or She4p.

Binding of the ASH1 mRNA by She2p likely initiates particle formation, yet a functional transport particle requires additional nuclear and cytoplasmic proteins. Whether She2p binds the mRNA within the nucleus or the cytoplasm remains unknown. The nuclear protein, Loc1p is a novel protein affecting ASH1 mRNA localization (Long et al., 2001). Although the ASH1 mRNA is exported from the nucleus in loc1 cells, the transcript is distributed throughout the cell, resulting in a she phenotype (Ash1p in mother and daughter nuclei). The diffuse appearance of the mRNA in loc1 cells indicates an inability to form particles. Thus, Loc1p may facilitate mRNA folding or otherwise assist in loading She2p onto the ASH1 transcript to initiate particle aggregation. She2p interactions with the nuclear importin Srp1p (Uetz et al., 2000) implicates She2p binding of the ASH1 mRNA within the nucleus before export or in conjunction with nuclear export of the transcript. The CP-GFP fusion used in these studies is capable of distinguishing between nuclear and cytoplasmic transcripts (Beach et al., 1999). Because we did not detect a nuclear GFP signal in she2 cells (Figure 4), She2p is apparently not required for nuclear export of the mRNA. Finally, She2p bound to the ASH1 transcript is required for the recruitment of She3p and subsequently She1p/Myo4p to form a mature transport particle (Munchow et al., 1999; Bohl et al., 2000; Long et al., 2000; Takizawa and Vale, 2000).

she4 mutants display defects in actin filament polarity, bud site selection, and endocytosis (Wendland et al., 1996). She4p is distributed throughout the cytoplasm and does not colocalize with the ASH1 mRNA, indicating that She4p does not specifically bind the ASH1 mRNA (Bertrand et al., 1998; Takizawa and Vale, 2000). Because perturbations of the actin cytoskeleton affect ASH1 mRNA localization without disrupting gRNAASH1 particle formation (Long et al., 1997; Takizawa et al., 1997; Beach et al., 1999; see below), the incomplete particle aggregation in she4 mutants reflects additional complexities in efficient particle formation.

she Mutants: Motors and Motor Attachment

In the absence of She1p/Myo4p, a type V myosin, the gRNAASH1 is no longer transported into the bud, although transcripts assemble into a discrete spot and remain motile (Figure 5, a–c; video sequence 5). The single spot (Figure 5b) moves throughout the mother cell at an average velocity of ∼0.6 μm/min (Beach et al., 1999). The composite image (Figure 5c) illustrates the movement of the spot over a period of 20 min taken from 20 sequential frames (video sequence 5). Observation of individual optical sections taken at increments of 0.75 μm indicates that the gRNA is cytoplasmic, contrasting with the cortical localization of the gRNA spots in wild-type cells. Although gRNAASH1 mRNA particles were never observed to cross the mother bud neck, spots accumulate in the daughter cell late in the cell cycle (video sequence 5). The accumulation of gRNAASH1 in the bud presumably results from transcription within the daughter nucleus after anaphase.

Figure 5.

Figure 5

She1p/Myo4p and She3p facilitate gRNAASH1 transport. In the absence of either She1p/Myo4p or She3p, gRNAASH1 remains in the mother cell. (a–c) Nomarski (a), single time point (b), and composite image (c) of a she1Δ/myo4Δ cell are shown (video sequence 5). The single gRNAASH1 spot is centrally located within the mother. The composite image (c) demonstrates the spot motility in the absence of the myosin motor. Twenty sequential images >20 min are presented in the single composite image (see text). (d–f) Nomarski (d), single time point (e), and composite image (f) of a she3Δ cell are shown (video sequence 6). As seen for she1 cells, the single gRNAASH1 spot is localized in the mother domain (below the bud). The composite image (f) represents 20 sequential images and the movement of a single spot >20 min. Bar, 5 μm.

Myo4p represents one of two class V myosins identified in budding yeast. Myo4p is suspected to have arisen from a gene duplication event of a second, class V myosin in yeast, MYO2, diverging in the globular tail domain (Haarer et al., 1994). In contrast to the dedicated role of Myo4p in RNA transport, Myo2p is a multifunctional motor protein responsible for vesicular and vacuolar traffic (Pruyne and Bretscher, 2000) as well as the transport of Kar9p into the bud (Beach et al., 2000; Yin et al., 2000). Myo2p-dependent transport of Kar9-GFP follows actin cables from the mother to the bud at an average velocity of ∼90 μm/min (Beach et al., 2000). In contrast, the Myo4p-dependent transport of ASH1 mRNA follows a nonlinear path at rates of 30 μm/min (Bertrand et al., 1998). Transport via both motors requires actin filaments. Depolymerization of actin filaments in tropomyosin mutant cells inhibits Myo2p- and Myo4p-dependent transport (Long et al., 1997; Pruyne et al., 1998; Beach et al., 2000).

Attachment of the gRNAASH1 to the myosin motor protein is mediated by She3p. Time-lapse images of gRNAASH1 spots in she3 cells are similar to the she1/myo4 strain (Figure 5, d–f; video sequence 6). gRNAASH1 spots are confined to the mother in she3 cells and move at a velocity of 0.8 ± 0.2 μm/min, similar to gRNAASH1 in she1/myo4 cells. A composite image (Figure 5f) illustrates the motility and range of the gRNAASH1 in the she3 cells. Spots are cytoplasmic, as determined by observation of the optical sections, and new spots appear within the bud late in the cell cycle (video sequence 6) as seen in she1/myo4 cells. Biochemical evidence supports a role for RNA loading onto She1p/Myo4p via She3p in association with She2p, and She1p/Myo4p and She3p form a complex in the absence of She2p or ASH1 mRNA (Munchow et al., 1999; Bohl et al., 2000; Long et al., 2000; Takizawa et al., 2000). Because an RNA particle forms in the absence of She3p, inclusion of a She3p-She1p complex is not required for particle formation. Thus, She3p acts as an adapter between She1p/Myo4p with the ASH1 transcript.

The myosin motor She1p/Myo4p tethers the ASH1 mRNA particle to actin. Cortical association of the mRNA is lost when Myo4p is unable to bind the mRNA in she1/myo4, she3, and she2 deletions. Thus, Myo4p, and the intervening proteins She2p and She3p serve as links connecting filamentous actin and the mRNA. Because particles formed in she4 cells are cytoplasmic, She4p may contribute to the cortical association of the mRNA as well, potentially facilitating the cross talk between actin polarity and mRNA particle formation.

she Mutants: Polarity Markers and Cortical Anchorage

Anchorage of the gRNAASH1 at the bud tip requires both She5p/Bni1p and Bud6p. Previous reports indicated that the ASH1 mRNA relocalized to the bud neck in fixed populations of she5/bni1 cells (Long et al., 1997; Takizawa et al., 1997; Bertrand et al., 1998). Subsequent live cell analysis revealed that the ASH1 mRNA is localized to the bud in a she5/bni1 strain but is not restricted to the bud tip as observed in wild-type cells (Beach et al., 1999). The gRNAASH1 spot returns to the neck before cell separation, which may establish a stable position for the mRNA as observed in fixed cell analyses. A single time point from the time-lapse series shows that the gRNAASH1 can be positioned adjacent to the neck (Figure 6b). Figure 6c represents 20 sequential images over a period of 20 min and demonstrates the dynamic distribution of the RNA throughout the bud over time (video sequence 7). gRNAASH1 spots move throughout the bud in the absence of She5p/Bni1p and are not observed in the mother cell (Figure 6, b and c; video sequence 7). The gRNAASH1 spots remain associated with the cortex, as determined from individual optical sections taken at 0.75-μm intervals through the cell. The fluorescent spot moves on the bud cortex at ∼0.5 μm/min (n = 4) (Beach et al., 1999).

Figure 6.

Figure 6

She5p/Bni1p and Bud6p/Aip3p anchor the gRNAASH1 at the bud tip. The retention of the gRNAASH1 at the bud tip is lost in she5Δ/bni1Δ and bud6Δ/aip3Δ cells. (a–c) In she5Δ/bni1Δ cells, the gRNAASH1 is transported into the bud and moves freely throughout the bud. (a) Brightfield image of the cell shown in b and c. (b) A single frame from the time lapse (video sequence 7) is shown, demonstrating a position of the gRNAASH1 proximal to the neck. (c) Composite time-lapse image is shown representing 20 sequential images, showing the distribution of the gRNAASH1 spot >20 min. (d–f) As observed for she5Δ/bni1Δ cells, gRNAASH1 is transported into the bud in bud6Δ/aip3Δ cells, and moves freely throughout the bud. (d) Brightfield image of the cell shown in e and f. (e) Single frame from the time lapse (video sequence 8) demonstrating a position of the gRNAASH1 proximal to the neck. (f) Composite time-lapse image is shown representing 20 sequential images showing the distribution of the gRNAASH1 spot >20 min. (g–i) Wild-type (YEF473a) cells are shown to compare gRNAASH1 localization distal from the neck (h) and as a composite image (i) representing 20 sequential images >20 min. (g) Brightfield image of the wild-type cell shown in h and i. Bar, 5 μm.

Live cell analysis of gRNAASH1 dynamics unveiled a sixth protein, Bud6p/Aip3p, required for proper ASH1 mRNA localization (Beach et al., 1999). Because both She5p/Bni1p and Bud6p/Aip3p are required to preserve cortical association of the microtubule anchor protein, Kar9p (Miller et al., 1999; Beach et al., 2000), we examined the role of Bud6p in the localization of ASH1 mRNA. In the absence of Bud6p, gRNAASH1 spots move throughout the bud, remaining associated with the cortex as seen for she5/bni1 cells (Figure 6, d–f; video sequence 8). A similar result is observed in bni1 bud6 double mutants such that the gRNAASH1 spot remains associated with the cortex yet not restricted to the bud tip (our unpublished results). The motile spots have an average velocity of ∼0.5 μm/min (Beach et al., 1999). Figure 6e contains a single time point, where the gRNAASH1 spot is mislocalized to the neck, whereas Figure 6f is a composite image consisting of 20 consecutive frames representing 20 min. The composite images of she5/bni1 and bud6/aip3 cells demonstrate the continued motility of the gRNAASH1 and dynamic distribution in these cells that is not seen in wild type (compare Figure 6,c, f, and i).

Bni1p/She5 and Bud6p/Aip3p are bud-specific proteins that appear to act as cell polarity cues within the bud. Both proteins participate in diploid bud site establishment, actin polarity, and alignment of the mitotic spindle (Amberg et al., 1997; Evangelista et al., 1997; Lee et al., 1999; Yeh et al., 2000). In the absence of either Bni1p or Bud6p, the ASH1 mRNA is released from a tight association at the bud tip. Although the actin cytoskeleton is disrupted in the bni1 and bud6 cells, the effect is not sufficient to inhibit directional transport of the message between the mother and bud. An intact linkage to the cortex, presumably through She3p and She4p (myosin V), indicates that Bni1p/She5p and Bud6p/Aip3p are not required for cortical interactions. Because both proteins populate the cortex at the bud tip (see above), mislocalization of the ASH1 mRNA in she5/bni1 or bud6/aips cells probably results from a loss of specific mRNA anchorage at the bud tip.

Bni1p/She5 and Bud6p/Aip3p also are required for localization of Kar9p to the bud cortex. Kar9p establishes microtubule and nuclear orientation early in the cell cycle by providing a polarized anchorage site for microtubules (Miller and Rose, 1998; Miller et al., 1999; Beach et al., 2000). In the absence of Kar9p, Bni1p, or Bud6p, the orientation and dynamics of the mitotic spindle are disrupted (Lee et al., 1999; Yeh et al., 2000). Although Kar9p is lost from the cortex in bni1 and bud6 cells, the ASH1 mRNA remains cortical and maintains particle integrity (see above). In addition to Bni1p and Bud6p, Spa2p localizes to the bud tip and is required with Bud6p for Bni1p localization (Ozaki-Kuroda et al., 2001). Taken together, these three proteins provide a nexus at the bud tip linking positional cues and asymmetric anchors.

mRNA Asymmetry Does Not Define Protein Localization

In addition to bud-specific proteins (i.e., Bni1p, Bud6p, Cdc42p, Sec3p, etc.), mother-specific proteins such as Yta6p have been identified. A screen for yeast orthologs of human proteosome constituents identified, among other genes, YTA6 (Schnall et al., 1994), a member of the AAA ATPase family (Vale, 2000). A GFP-Yta6 fusion protein forms punctate spots of fluorescence specifically on the mother cortex that are absent from the bud cortex of small and medium budded cells (Figure 7, a–e; video sequence 9). In cells with large buds, GFP-Yta6 begins to accumulate within the bud near the time of anaphase onset (Figure 7, a′–e′; video sequence 9). GFP-Yta6 first appears in the bud as small, dim spots, which increase in number and brightness with time. Spots remain relatively stationary in either mother or bud, appearing to move within small domains (video sequence 9). The localization of GFP-Yta6 was unchanged in cells deleted for the chromosomal YTA6 locus (our unpublished results).

Figure 7.

Figure 7

GFP-Yta6 localizes to the maternal cortex. (a–e) Several cells are shown with GFP-Yta6 spots on the mother cell cortex. Medium budded cells (a–d) contain GFP-Yta6 only in the mother cell, while the large budded cell (e) contains GFP-Yta6 in both mother and bud domains. (a′–e′) The same cells 150 min later. Cells b–e have completed cell separation with Yta6p present in the daughter cells. Cell a′ has not completed cell separation, yet Yta6p is localized in the bud. White lines denote the cell outline as determined from the brightfield image. Video sequence 9 demonstrates the accumulation of YTA6p in the bud late in the cell cycle and includes panels showing the nuclear cycle (Histone H4-CFP). (f and g) The localization of Yta6-ASH1 fusion protein and mRNA is shown in a cell expressing GFP-Yta6-ASH1 3′ UTR fusion and CP-GFP (video sequence 10). The mRNA is localized to the bud tip throughout the time lapse (f and g), whereas the Yta6-Ash1 fusion protein is only in the mother in small budded cells (f) and in both mother and bud in large budded cells (g). Numbers in the lower right corner (f and g) represent an elapsed time (hh:mm) corresponding with video sequence 10. Bars (top and bottom), 5 μm.

To determine the contribution of mRNA targeting versus peptide sequences for protein localization, we fused the ASH1 3′ UTR downstream of the YTA6 coding region to direct mRNA into the bud. The fusion places the E3 domain of the ASH1 3′ UTR downstream of the GFP-Yta6, and includes MS2 sites to visualize the transcript. Expression of the GFP-YTA6-MS2-ASH1/E3 (referred to as GFP-Yta6-ASH1) fusion protein in unsynchronized, haploid cells resulted in a distribution of fluorescent spots similar to those seen for GFP-Yta6. The GFP-Yta6-ASH1 protein formed nonmotile, punctate spots of fluorescent throughout the mother cortex of unbudded, small, and medium budded cells, and accumulated in large budded cells (see Figure 7, g and h, for representative images).

To determine the localization of the GFP-Yta6-ASH1 fusion mRNA, we coexpressed the fusion protein with CP-GFP. Coexpression of both GFP fusion proteins in unsynchronized, haploid yta6Δ cells produced the wild-type distribution of GFP-Yta6 spots within the mother, and a single, bright spot at the bud tip (Figure 7f; video sequence 10). The fluorescent spot at the bud tip is exclusive within the bud and localized tightly to the bud tip. The fluorescent spot at the bud tip appears brighter than GFP-Yta6 on the mother cortex and was not observed in cells lacking CP-GFP. Late in the cell cycle, GFP-Yta6-ASH1 spots accumulate in the bud as observed for wild-type cells (Figure 7g; video sequence 10). Thus, directing the YTA6 mRNA into the bud did not alter the mother specific localization of the protein.

The maternal localization of the GFP-Yta6-ASH1 fusion protein could result from protein expressed in the previous cell cycle. To evaluate the distribution a protein transcribed from a mRNA localized within the bud, we restricted expression of the fusion protein to large budded cells. Cells were arrested at mitosis with large buds before GFP-Yta6-ASH1 induction (see MATERIALS AND METHODS). All of the cells observed contained GFP-Yta6-ASH1 fluorescent spots within the mother (n > 500), similar to wild-type GFP-Yta6. We conclude that the localization of the GFP-YTA6-ASH1 fusion protein is not altered by directing the mRNA to the bud tip.

The resulting position for Ash1p, GFP-YTA6, or GFP-YTA6-ASH1 is indicative of a hierarchy of peptide signals over RNA localization signal sequences. Transcription of ASH1 late in the cell cycle and restricted translation of the protein to the bud results in the preferential accumulation of Ash1p in the daughter nucleus. However, Ash1p is equally competent to enter either nucleus, as evident upon overexpression of ASH1. Thus, in the absence of stringent regulation of mRNA localization and protein levels the protein accumulates in both nuclei. In contrast, the mother-specific localization of Yta6p is not affected by transcript localization. Localized mRNA translation therefore does not override the protein localization machinery.

Extensions of Live Cell Imaging

The extension of live cell imaging to the “RNA world” enables cell biologists to follow the path of mRNA transcripts in live cells. Whole genome screening and empirical observation have identified additional asymmetrically distributed transcripts, including a second bud-specific mRNA, IST2 (Takizawa et al., 2000), as well as nuclear messages targeted to the mitochondria (Corral-Debrinski et al., 2000). Such facilitated placement of messages within the already compact yeast cell illustrates the biological importance of site-specific translation. Cross talk between cell polarity determinants and the mRNA localization pathway indicate synergy between mechanisms establishing cell polarity and mRNA localization. The coupling of these inherently asymmetric processes is likely to represent conserved features responsible for establishing asymmetries in development.

Supplementary Material

View video(s) (associated with Figure 2)
Download video file (1.6MB, mov)
View video(s) (associated with Figure 3)
Download video file (2MB, mov)
View video 3 (associated with Figure 4)
Download video file (1.1MB, mov)
View video 4 (associated with Figure 4)
Download video file (1.4MB, mov)
View video 5 (associated with Figure 5)
Download video file (1,020KB, mov)
View video 6 (associated with Figure 5)
Download video file (1MB, mov)
View video 7 (associated with Figure 6)
Download video file (785.8KB, mov)
View video 8 (associated with Figure 6)
Download video file (709.2KB, mov)
View video(s) (associated with Figure 7)
Download video file (6.3MB, mov)
View video(s) (associated with Figure 7)
Download video file (663.2KB, mov)

ACKNOWLEDGMENTS

We thank Elaine Yeh for critical reading of the manuscript, Ted Salmon (University of North Carolina, Chapel Hill, NC) for inspired guidance, David Peabody (University of New Mexico School of Medicine, Albuquerque, NM) and Roy Long (Medical College of Wisconsin, Milwaukee, WI) for providing plasmids carrying the MS2 CPdlFG allele, Don Katcoff (Bar Ilan University, Ramat Gan, Israel) and John Pringle (University of North Carolina, Chapel Hill, NC) for yeast strains, and Jennifer Stemple and Jennifer Mott for technical assistance. This work is supported by a National Institutes of Health Grant GM-32238 issued to K.B.

Footnotes

V⃞

Online version of this article contains video material for Figures 27. Online version available at www.molbiolcell.org.

REFERENCES

  1. Adams AEM, Pringle JR. Relationship of actin and tubulin distribution to bud growth in wild-type and morphogenetic-mutant Saccharomyces cerevisiae. J Cell Biol. 1984;98:934–945. doi: 10.1083/jcb.98.3.934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ainger K, Avossa D, Morgan F, Hill SJ, Barry C, Barbarese E, Carson JH. Transport and localization of exogenous myelin basic protein mRNA microinjected into oligodendrocytes. J Cell Biol. 1993;123:431–441. doi: 10.1083/jcb.123.2.431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Amberg DC, Zahner JE, Mulholland JW, Pringle JR, Botstein D. Aip3p/Bud6p, a yeast actin-interacting protein that is involved in morphogenesis and the selection of bipolar budding sites. Mol Biol Cell. 1997;8:729–753. doi: 10.1091/mbc.8.4.729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barral Y, Mermall V, Mooseker M, Snyder M. Compartmentalization of the cell cortex by septins is required for maintenance of cell polarity in yeast. Mol Cell. 2000;5:841–851. doi: 10.1016/s1097-2765(00)80324-x. [DOI] [PubMed] [Google Scholar]
  5. Beach DL, Salmon ED, Bloom K. Localization and anchoring of mRNA in budding yeast. Curr Biol. 1999;9:569–578. doi: 10.1016/s0960-9822(99)80260-7. [DOI] [PubMed] [Google Scholar]
  6. Beach DL, Thibodeaux J, Maddox P, Yeh E, Bloom K. The role of the proteins Kar9 and Myo2 in orienting the mitotic spindle of budding yeast. Curr Biol. 2000;10:1497–506. doi: 10.1016/s0960-9822(00)00837-x. [DOI] [PubMed] [Google Scholar]
  7. Bertrand E, Chartrand P, Schaefer M, Shenoy SM, Singer RH, Long RM. Localization of ASH1 mRNA particles in living yeast. Mol Cell. 1998;2:437–445. doi: 10.1016/s1097-2765(00)80143-4. [DOI] [PubMed] [Google Scholar]
  8. Bi E, Maddox P, Lew DJ, Salmon ED, McMillan JH, Yeh E, Pringle JR. Roles of a nonessential actomyosin contractile ring and of the septins in Saccharomyces cerevisiae cytokinesis. J Cell Biol. 1998;142:1301–1312. doi: 10.1083/jcb.142.5.1301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bobola N, Jansen R-P, Shin TH, Nasmyth K. Asymmetric accumulation of Ash1p in postanaphase nuclei depends on a myosin and restricts yeast mating-type switching to mother cells. Cell. 1996;84:699–709. doi: 10.1016/s0092-8674(00)81048-x. [DOI] [PubMed] [Google Scholar]
  10. Bohl F, Kruse C, Frank A, Ferring D, Jansen RP. She2p, a novel RNA-binding protein tethers ASH1 mRNA to the Myo4p myosin motor via She3p. EMBO J. 2000;19:5514–5524. doi: 10.1093/emboj/19.20.5514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Brock TD, Madigan MT, Martinko JM, Parker J. Biology of Microorganisms. 7th ed. Englewood Cliffs, NJ: Prentice Hall; 1994. [Google Scholar]
  12. Chandarlapaty S, Errede B. Ash1, a daughter cell-specific protein, is required for pseudohyphal growth of Saccharomyces cerevisiae. Mol Cell Biol. 1998;18:2884–2891. doi: 10.1128/mcb.18.5.2884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chartrand P, Meng X-H, Singer RH, Long RM. Structural elements required for the localization of ASH1 mRNA and of a green fluorescent protein reporter particle in vivo. Curr Biol. 1999;9:333–336. doi: 10.1016/s0960-9822(99)80144-4. [DOI] [PubMed] [Google Scholar]
  14. Corral-Debrinski M, Blugeon C, Jacq C. In yeast, the 3′ untranslated region or the presequence of ATM1 is required for the exclusive localization of its mRNA to the vicinity of mitochondria. Mol Cell Biol. 2000;20:7881–7892. doi: 10.1128/mcb.20.21.7881-7892.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Evangelista M, Blundell K, Longtine MS, Chow CJ, Adames N, Pringle JR, Peter M, Boone C. Bni1p, a yeast formin linking Cdc42p and the actin cytoskeleton during polarized morphogenesis. Science. 1997;276:118–122. doi: 10.1126/science.276.5309.118. [DOI] [PubMed] [Google Scholar]
  16. Ferrandon D, Elphick L, Nusslein-Volhard C, St. Johnston D. Staufen protein associates with the 3′UTR of bicoid mRNA to form particles that move in a microtubule-dependent manner. Cell. 1994;79:1221–1232. doi: 10.1016/0092-8674(94)90013-2. [DOI] [PubMed] [Google Scholar]
  17. Gonzalez I, Buonomo SBC, Nasmyth K, Von Ahsen U. ASH1 mRNA localization in yeast involves multiple secondary structural elements and Ash1 protein translation. Curr Biol. 1999;9:337–340. doi: 10.1016/s0960-9822(99)80145-6. [DOI] [PubMed] [Google Scholar]
  18. Haarer BK, Petzold A, Lillie SH, Brown SS. Identification of MYO4, a second class V myosin gene in yeast. J Cell Sci. 1994;107:1055–1064. doi: 10.1242/jcs.107.4.1055. [DOI] [PubMed] [Google Scholar]
  19. Im KH, Cosgrove DJ, Jones AM. Subcellular localization of expansin mRNA in xylem cells. Plant Physiol. 2000;123:463–470. doi: 10.1104/pp.123.2.463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jansen RP, Dowzer C, Michaelis C, Galova M, Nasmyth K. Mother cell-specific HO expression in budding yeast depends on the unconventional myosin Myo4p and other cytoplasmic proteins. Cell. 1996;84:687–697. doi: 10.1016/s0092-8674(00)81047-8. [DOI] [PubMed] [Google Scholar]
  21. Jeffrey WR, Tomlinson CR, Brodeaur RD. Localization of actin messenger RNA during early ascidian development. Dev Biol. 1983;99:408–417. doi: 10.1016/0012-1606(83)90290-7. [DOI] [PubMed] [Google Scholar]
  22. Lee L, Klee SK, Evangelista M, Bonne C, Pellman D. Control of mitotic spindle position by the Saccharomyces cerevisiae formin Bni1p. J Cell Biol. 1999;144:947–961. doi: 10.1083/jcb.144.5.947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Long RM, Gu W, Lorimer E, Singer RH, Chartrand P. She2p is a novel RNA-binding protein that recruits the Myo4p-She3p complex to ASH1 mRNA. EMBO J. 2000;19:6592–6601. doi: 10.1093/emboj/19.23.6592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Long RM, Gu W, Meng X, Gonzalvez G, Singer RH, Chartrand P. An exclusively nuclear RNA-binding protein affects asymmetric localization of ASH1 mRNA, and Ash1p in yeast. J Cell Biol. 2001;153:307–318. doi: 10.1083/jcb.153.2.307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Long RM, Singer RH, Meng X, Gonzalez I, Nasmyth K, Jansen R-P. Mating type switching in yeast controlled by asymmetric localization of ASH1 mRNA. Science. 1997;277:383–387. doi: 10.1126/science.277.5324.383. [DOI] [PubMed] [Google Scholar]
  26. Maxon ME, Herskowitz I. Ash1p is a site-specific DNA-binding protein that actively represses transcription. Proc Natl Acad Sci USA. 2001;98:1495–1500. doi: 10.1073/pnas.98.4.1495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Michaelis C, Ciosk R, Nasmyth K. Cohesins: chromosomal proteins that prevent premature separation of sister chromatids. Cell. 1997;91:35–45. doi: 10.1016/s0092-8674(01)80007-6. [DOI] [PubMed] [Google Scholar]
  28. Miller R, Matheos D, Rose M. The cortical localization of the microtubule orientation protein, Kar9p, is dependent upon actin and proteins required for polarization. J Cell Biol. 1999;144:963–975. doi: 10.1083/jcb.144.5.963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Miller RK, Rose MD. Kar9p is a novel cortical protein required for cytoplasmic microtubule orientation in yeast. J Cell Biol. 1998;140:377–390. doi: 10.1083/jcb.140.2.377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Munchow S, Sauter C, Jansen RP. Association of the class V myosin Myo4p with a localized messenger RNA in budding yeast depends on She proteins. J Cell Sci. 1999;112:1511–1518. doi: 10.1242/jcs.112.10.1511. [DOI] [PubMed] [Google Scholar]
  31. Ozaki-Kuroda K, Yamamoto Y, Nohara H, Kinoshita M, Fujiwara T, Irie K, Takai Y. Dynamic localization, and function of Bni1p at the sites of directed growth in Saccharomyces cerevisiae. Mol Cell Biol. 2001;21:827–839. doi: 10.1128/MCB.21.3.827-839.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Peabody DS. Translational repression by bacteriophage MS2 coat protein expressed from a plasmid. J Biol Chem. 1990;265:5684–5689. [PubMed] [Google Scholar]
  33. Peabody DS, Ely KR. Control of translational repression by protein-protein interactions. Nucleic Acids Res. 1992;20:1649–1655. doi: 10.1093/nar/20.7.1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pringle JR, Bi E, Harkins HA, Zahner JE, De VC, Chant J, Corrado K, Fares H. Establishment of cell polarity in yeast. Cold Spring Harb Symp Quant Biol. 1995;60:729–44. doi: 10.1101/sqb.1995.060.01.079. [DOI] [PubMed] [Google Scholar]
  35. Pruyne D, Bretscher A. Polarization of cell growth in yeast. J Cell Sci. 2000;113:571–585. doi: 10.1242/jcs.113.4.571. [DOI] [PubMed] [Google Scholar]
  36. Pruyne DW, Schott DH, Bretscher A. Tropomyosin-containing actin cables direct the Myo2p-dependent polarized delivery of secretory vesicles in budding yeast. J Cell Biol. 1998;143:1931–1945. doi: 10.1083/jcb.143.7.1931. [DOI] [PubMed] [Google Scholar]
  37. Robinett CC, Straight A, Li G, Willhelm C, Sudlow G, Murray A, Belmont AS. In vivo localization of DNA sequences and visualization of large-scale chromatin organization using Lac operator/repressor recognition. J Cell Biol. 1996;135:1685–1700. doi: 10.1083/jcb.135.6.1685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rook MS, Lu M, Kosik K. CaMKIIα 3′ untranslated region-directed mRNA translocation in living neurons: visualization by GFP Linkage. J Neurosci. 2000;20:6385–6393. doi: 10.1523/JNEUROSCI.20-17-06385.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Schnall R, Mannhaupt G, Stucka R, Tauer R, Ehnle S, Schwarz-lose C, Vetter I, Feldmann H. Identification of a set of yeast genes coding for a novel family of putative ATPases with high similarity to constituents of the 26S protease complex. Yeast. 1994;10:1141–1155. doi: 10.1002/yea.320100903. [DOI] [PubMed] [Google Scholar]
  40. Segal M, Bloom K, Reed SI. Bud6 directs sequential microtubule interactions with the bud tip and bud neck during spindle morphogenesis in Saccharomyces cerevisiae. Mol Biol Cell. 2000;11:3689–3702. doi: 10.1091/mbc.11.11.3689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. SenGupta DJ, Zhang B, Kraemer B, Pochart P, Fields S, Wickens M. A three-hybrid system to detect RNA-protein interactions in vivo. Proc Natl Acad Sci USA. 1996;93:8496–8501. doi: 10.1073/pnas.93.16.8496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Shaw SL, Yeh E, Bloom K, Salmon ED. Imaging green fluorescent protein fusion proteins in Saccharomyces cerevisiae. Curr Biol. 1997;7:701–704. doi: 10.1016/s0960-9822(06)00299-5. [DOI] [PubMed] [Google Scholar]
  43. Sil A, Herskowitz I. Identification of asymmetrically localized determinant, Ash1p, required for lineage-specific transcription of the yeast HO gene [see comments] Cell. 1996;84:711–722. doi: 10.1016/s0092-8674(00)81049-1. [DOI] [PubMed] [Google Scholar]
  44. St. Johnston D. The intracellular localization of messenger RNAs. Cell. 1995;81:161–170. doi: 10.1016/0092-8674(95)90324-0. [DOI] [PubMed] [Google Scholar]
  45. Stripecke R, Oliveira CC, McCarthy JEG, Hentze MW. Proteins binding to 5′ untranslated region sites: a general mechanism for translational regulation of mRNAs in human and yeast cells. Mol Cell Biol. 1994;14:5898–5909. doi: 10.1128/mcb.14.9.5898-5909.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Takizawa P, DeRisi J, Wilhelm J, Vale R. Plasma membrane compartmentalization in yeast by messenger RNA transport and a septin diffusion barrier. Science. 2000;290:341–344. doi: 10.1126/science.290.5490.341. [DOI] [PubMed] [Google Scholar]
  47. Takizawa PA, Sil A, Swedlow JR, Herskowitz I, Vale RD. Actin-dependent localization of an RNA encoding a cell-fate determinant in yeast. Nature. 1997;389:90–93. doi: 10.1038/38015. [DOI] [PubMed] [Google Scholar]
  48. Takizawa PA, Vale RD. The myosin motor, Myo4p, binds Ash1 mRNA via the adapter protein, She3p. Proc Natl Acad Sci USA. 2000;97:5273–5278. doi: 10.1073/pnas.080585897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Theurkauf WE, Hazelrigg TI. In vivo analyses of cytoplasmic transport and cytoskeletal organization during Drosophila oogenesis: characterization of a multi-step anterior localization pathway. Development. 1998;125:3655–3666. doi: 10.1242/dev.125.18.3655. [DOI] [PubMed] [Google Scholar]
  50. Uetz P, Giot L, Cagney G, Mansfield TA, Judson RS, Knight JR, Lockshon D, Narayan V, Srinivasan M, Pochart P, Qureshi-Emili A, Li Y, Godwin B, Conover D, Kalbfleisch T, Vijayadamodar G, Yang M, Johnston M, Fields S, Rothberg JM. A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature. 2000;403:623–627. doi: 10.1038/35001009. [DOI] [PubMed] [Google Scholar]
  51. Vale RD. AAA proteins. Lords of the ring. J Cell Biol. 2000;150:F13–9. doi: 10.1083/jcb.150.1.f13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wach A, Brachat A, Pohlmann R, Philippsen P. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast. 1994;10:1793–1808. doi: 10.1002/yea.320101310. [DOI] [PubMed] [Google Scholar]
  53. Wendland B, McCaffery JM, Xiao Q, Emr SD. A novel fluorescence-activated cell sorter-based screen for yeast endocytosis mutants identifies a yeast homologue of mammalian eps15. J Cell Biol. 1996;135:1485–500. doi: 10.1083/jcb.135.6.1485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wilhelm JE, Mansfield J, Hom-Booher N, Wang S, Turck CW, Hazelrigg T, Vale RD. Isolation of a ribonucleoprotein complex involved in mRNA localization in Drosophila oocytes. J Cell Biol. 2000;148:427–440. doi: 10.1083/jcb.148.3.427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Yeh E, Yang C, Chin E, Maddox P, Salmon ED, Lew DJ, Bloom K. Dynamic positioning of mitotic spindles in yeast. Role of microtubule motors and cortical determinants. Mol Biol Cell. 2000;11:3949–3961. doi: 10.1091/mbc.11.11.3949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yin H, Pruyne D, Huffaker TC, Bretscher A. Myosin V orients the mitotic spindle in yeast. Nature. 2000;406:1013–1015. doi: 10.1038/35023024. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

View video(s) (associated with Figure 2)
Download video file (1.6MB, mov)
View video(s) (associated with Figure 3)
Download video file (2MB, mov)
View video 3 (associated with Figure 4)
Download video file (1.1MB, mov)
View video 4 (associated with Figure 4)
Download video file (1.4MB, mov)
View video 5 (associated with Figure 5)
Download video file (1,020KB, mov)
View video 6 (associated with Figure 5)
Download video file (1MB, mov)
View video 7 (associated with Figure 6)
Download video file (785.8KB, mov)
View video 8 (associated with Figure 6)
Download video file (709.2KB, mov)
View video(s) (associated with Figure 7)
Download video file (6.3MB, mov)
View video(s) (associated with Figure 7)
Download video file (663.2KB, mov)

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology

RESOURCES