REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse IgG1 Anti-Pol II CTD mAb	MBL Life Science	MABI0601
Anti-Phospho Pol II CTD (Ser5) mAb	MBL Life Science	MABI0603
Anti-Actin antibody produced in rabbit	Sigma	A2066 RRID:AB_476693
Rabbit anti-CPSF30 Antibody, Affinity Purified	Bethyl Laboratories	A301-584A RRID:AB_1078872
Bacterial and Virus Strains
H1N1 Influenza Virus, A/WSN/33	(Fodor et al., 1999)	WSN
H1N1 Influenza Virus, A/Puerto Rico/8/34	(Subbarao et al., 2003)	PR8
H3N2 Influenza Virus, A/Udorn/72	(Jackson et al., 2010)	Ud
Influenza B Virus, B/Florida/04/2006	(Jackson et al., 2011)	B/FL
H3N2 Influenza Virus, A/Udorn/72: NS1Δ99	(Jackson et al., 2010)	UdDel99
Chemicals, Peptides, and Recombinant Proteins
RNAiMAX transfection reagent	Invitrogen	13778-150
Reagents for mNET-seq sample preparation	(Nojima et al., 2016)	See paper for details
Critical Commercial Assays
Brilliant III Ultra-Fast SYBR Green QPCR Master Mix	Agilent	600889
Reagents for mNET-seq sample preparation	(Nojima et al., 2016)	See paper for details
Quick-RNA microprep kit	Zymo Research	R1050
TruSeq Small RNA Library Preparation kit	Illumina	RS-200-0012
NEBNext Small RNA Library Preparation kit	NEB	E7300
Bioanalyzer Agilent High Sensitivity DNA Kit	Agilent	5067-4626
Qubit dsDNA HS Assay Kit	Invitrogen	Q32851
Deposited Data
Raw sequencing data	This paper; NCBI SRA	SRP132032
Poly(A) Site usage	(Neve et al., 2016)	See source SI
Lists of DoG transcript genes during osmotic shock	(Vilborg et al., 2015)	See source SI
Experimental Models: Cell Lines
Human adenocarcinoma alveolar basal epithelial cells (A549)	ATCC	A549 RRID:CVCL_0023
Madin-Darby Bovine Kidney cells (MDBK)	ATCC	MDBK RRID:CVCL_0421
Madin-Darby Canine Kidney cells (MDCK)	ATCC	MDCK RRID:CVCL_0422
Human embryonic kidney 293 Flp-In TRex: NS1wt	(Davidson et al., 2014)	NS1wt
Human embryonic kidney 293 Flp-In TRex: NS1mut	(Davidson et al., 2014)	NS1mut
Oligonucleotides
Control siRNA (siLuc) Sense (5′-3′): GAUUAUGUCCGGUUAUGUAUU Antisense (5′-3′): [p]UACAUAACCGGACAUAAUCUU	(Nojima et al., 2015)	siLuc
SMARTpool ON-TARGETplus CPSF4 siRNA	Dharmacon	012292-01
Random primers for reverse transcription	Invitrogen	48190011
qPCR primers	This paper and (Vilborg et al., 2015)	See Table S2
Software and Algorithms
STAR	(Dobin et al., 2013)	https://github.com/alexdobin/STAR
mNET_snr	(Nojima et al., 2016)	https://github.com/tomasgomes/mNET_snr
deepTools	(Ramírez et al., 2014)	https://github.com/deeptools/deepTools
Integrative Genomics Viewer (IGV)	(Robinson et al., 2011)	http://software.broadinstitute.org/software/igv/
R: A language and environment for statistical computing	R Foundation for Statistical Computing	https://www.R-project.org/
Other
Genome sequence, primary assembly (GRCh38)	Genome Reference Consortium	ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/release_27/GRCh38.primary_assembly.genome.fa.gz
GENCODE v27 human genome annotations	(Harrow et al., 2012)	https://www.gencodegenes.org/releases/27.html