REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-histone H3 (phospho S10) antibody.	Abcam	Cat#AB47297
Cardiac Troponin T Monoclonal Antibody (13-11)	Thermo Fisher Scientific	Cat#MA5-12960
anti-GAPDH antibody	Abcam	Cat#AB9484
anti-P27 antibody	Abcam	Cat#AB32034
anti-phospho-Chk1 (Ser345)	Cell Signaling	Cat#2348
anti-phospho-Chk2 (Thr68)	Cell Signaling	Cat#2197
anti-phospho-ATM (Ser1981)	Cell Signaling	Cat#5883
Bacterial and Virus Strains
pENTR11	Thermo Fisher Scientific	Cat#A10467
pAd/CMV/V5-DEST	Thermo Fisher Scientific	Cat#V49320
Chemicals, Peptides, and Recombinant Proteins
SB144352	Tocris	Cat#1614
MK1775	Selleckchem	Cat#S1525
Critical Commercial Assays
Click-iT™ EdU Alexa Fluor™ 647 Imaging Kit	Thermo Fisher Scientific	Cat#C10340
Click-iT™ EdU Alexa Fluor™ 488 Imaging Kit	Thermo Fisher Scientific	Cat#C10337
Deposited Data
Transcriptome data for figure 1A	GEO	GSE14414
RNAseq data for Extended data figures S5	GEO	GSE97730
Experimental Models: Organisms/Strains
Igs2tm2(ACTB-tdTomato,-EGFP)Luo/J	JAX Laboratories	Cat#013751
Igs2tm1(ACTB-EGFP,-tdTomato)Luo/J	JAX Laboratories	Cat#013749
Tg(CAG-cre/Esr1*)5Amc	JAX Laboratories	Cat#004682
B6.FVB(129)-A1cfTg(Myh6-cre/Esr1*)1Jmk/J	JAX Laboratories	Cat#005657
Tg(Tnnt2-cre)5Blh	JAX Laboratories	Cat#024240
C57BL/6J mice	JAX Laboratories	Cat#000664
Sprague Dawley rats	Charles River	Cat#400
Oligonucleotides
GeneSolution siRNA targeting P27 (CDKN1B) Target sequence ACCGACGATTCTTCTACTCAA	Qiagen	Cat#1027416
Recombinant DNA
Gateway™ pENTR™ 11 Dual Selection Vector	Thermo Fisher Scientific	Cat#A10467
pAd/CMV/V5-DEST™ Gateway™ Vector Kit	Thermo Fisher Scientific	Cat#V49320