Table 1.
Real Time Polymerase Chain Reaction Primers Used in the Current Study
| Gene (ERα) | Primer sequence (5´→3´) | Length | Temperature |
|---|---|---|---|
| Forward primer | AGACATGAGAGCTGCCAACC | 20 | 58.04 |
| Reverse primer | GCCAGGCACATTCTAGAAGG | 20 | 57.33 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.