Table 1.
Analysis of the three (GATA)n-containing subclones with respect to repeat number, allele length and number of alleles
| No. | OS1A6 | OS1H10 | OS2E7 | |
| 1 | Original phage clone | GATA 7.1 | GATA 3.1 | GATA 8.1 |
| number from which | ||||
| derived | ||||
| 2 | Restriction endonuclease | MspI | TaqI | TaqI |
| used to digest phage DNA | ||||
| 3 | Subcloning vector | pUC-18 | pUC-18 | pUC-18 |
| 4 | Cloning site | AccI | AccI | AccI |
| 5 | GenBank accession | AF294726 | AF285877 | AF284424 |
| number | ||||
| 6 | Number of GATA motifs | 7 imperfect | 7 perfect | 13 imperfect |
| GATATA (GATA)6 | (GATA)7 | AATA (GATA)3 GAA (GATA)4 | ||
| AGTA GAAA GATG AGTA | ||||
| 7 | Primer sequences used for | F | F | F |
| 5'GCTGCGCAGTGTATGCGTCT3' | 5'GAGTGGTCTCAGTTTGGTGC3' | 5'AAGTGGCGACGTGAGAGCG3' | ||
| PCR amplification | ||||
| R | R | R | ||
| 5'ACCATTTAACAGCTAATCGA3' | 5'TGGCGGCTGGAGAGCGTTTG3' | 5'GTTAAGACAGTCCCCAGTG3' | ||
| 8 | Annealing temperature | 55°C | 67°C with 2% formamide | 57°C with 2% formamide |
| 9 | Size of expected PCR | 184 bp | 263 bp | 141 bp |
| product (from genomic | ||||
| subclone sequence) | ||||
| 10 | Number and size range of | |||
| alleles detected in | ||||
| (A) Wild and cultivated rice | 7 (184 bp–208 bp) | 22 (116–521 bp) | Unscorable ladder-like | |
| genotypes | pattern obtained | |||
| (B) Indian elite rice | 3 (174–197 bp) | 10 (218–292 bp) | 4 (157–179 bp) | |
| varieties | ||||
| (C)Bacterial blight | 5 (171–198 bp) | 19 (140–535 bp) | 6 (117–143 bp) | |
| resistant and | ||||
| (D) Cereal genotypes | 1 (184 bp) | 6 (168–270 bp) | - | |
| 11 | Maximum number of | |||
| bands per lane in | ||||
| (A) Wild and cultivated rice | 2 | 7 | - | |
| genotypes | ||||
| (B) Indian elite rice | 3 | 3 | 3 | |
| varieties | ||||
| C) Bacterial blight resistant | 2 | 9 | 4 | |
| and susceptible lines | ||||
| (D) Cereal genotypes | 1 | 3 | - |