Skip to main content
. 2018 May 16;19(5):1488. doi: 10.3390/ijms19051488

Table 1.

Information of selected microRNAs. The MFE (minimum free energy) of each microRNA was predicted using the RNAhybrid Service.

MicroRNA Name Sequence MFE (kcal/mol)
hsa-miR-150-3p ctggtacaggcctgggggacag −33.6 for GP or −32.0 for VP40
hsa-miR-15a-3p caggccatattgtgctgcctca −31.4 for GP
hsa-miR-449c-5p taggcagtgtattgctagcggctgt −31.2 for Reporter
hsa-miR-10a-5p taccctgtagatccgaatttgtg −31.1 for Ebola trailer region
hsa-miR-361-3p tcccccaggtgtgattctgattt −30.5 for VP40
hsa-miR-210-3p ctgtgcgtgtgacagcggctga −30.0 for NCR (30/24)
hsa-miR-103b tcatagccctgtacaatgctgct −29.3 for VP24