| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| α-H3K27me3 (ChIP-seq) | Diagenode | Cat# C15410195 |
| α-H3K27me3 (Immunofluorescence) | Gift from Dr. T. Jenuwein | N/A |
| α-H3K9me3 | Diagenode | Cat# C15410193 |
| α-H3K27ac | Diagenode | Cat# C15410196; RRID:AB_2637079 |
| α-H3K4me3 | Diagenode | Cat #pAb-003-050; RRID:AB_2616052 |
| α-H3K36me3 | Diagenode | Cat #pAb-192-050 |
| α-H2AK119ub | Cell Signaling | Cat# 8240; RRID:AB_10891618 |
| α-H3K27me2 | Diagenode | Cat# C15410046 |
| α-H3K27me1 | Diagenode | Cat# C15410045 |
| α-H3 | Active Motif | Cat# 39763; RRID:AB_2650522 |
| α-Pol-II | Diagenode | Cat #C15200004 |
| α-Insulin | DAKO | Cat# A056401-2; AB_2617169 |
| α-Glucagon | Novus | Cat# K79bB10; AB_790003 |
| α-Pancreatic Polypeptide | Novus | Cat# NB100-1793; RRID:AB_2268669 |
| α-Somatostatin | Bio-Rad/AbD Serotec | Cat# 8330-0009; RRID:AB_2195908 |
| α-Chromogranin A | Thermo Fisher Scientific | Cat# PA1-37445; RRID:AB_2080987 |
| α-Nkx6-1 | Dev. Studies Hybridoma Bank | Cat# F55A12; RRID:AB_532379 |
| α-MafA | Bethyl Laboratories | Cat# IHC-00352; RRID:AB_1279486 |
| α-Nkx2-2 | Dev. Studies Hybridoma Bank | Cat# 74.5A5; RRID:AB_531794 |
| α-Pdx1 | Dev. Studies Hybridoma Bank | Cat# F6A11; RRID:AB_1157904 |
| α-GFP/YFP | Thermo Fisher Scientific | Cat#A-11122; RRID:AB_221569 |
| Biological Samples | ||
| Human pancreas donor paraffin blocks | Network for Pancreatic Organ Donors with Diabetes | http://www.jdrfnpod.org/; RRID: SCR_014641 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| SAHA, MK0683 | Selleckchem | Cat#S1047 |
| β-Cyclodextrin | Sigma | Cat#332607 |
| TRI Reagent | Sigma | Cat#T9424 |
| Glyco Blue Coprecipitant | Thermo Fisher Scientific | Cat#AM9516 |
| Vapor-Lock | Qiagen | Cat#981611 |
| AMPure XP beads | Beckman Coulter | Cat#A63881 |
| Agencount RNAClean beads | Beckman Coulter | Cat#A63987 |
| Roti-HistoFix 4% | Carl Roth | Cat#P087.1 |
| HistoVT One | Nacalai Tesque | Cat#06380-05 |
| RPMI-1640 Medium with GlutMAX supplement | Thermo Fisher Scientific | Cat#61870-010 |
| Collegenase XI | Sigma | Cat #C7657 |
| Histopaque (1.077 g/mL) | Sigma | Cat# 10771 |
| Critical Commercial Assays | ||
| Mercodia Ultrasensitive Insulin ELISA | Mercodia | Cat#10-1132-01 |
| MEGAscript T7 Transcription Kit | Thermo Fisher Scientific | Cat# AM1334 |
| Illumina Tru Seq RNA Sample Prep Kit v2 | Illumina | Cat#RS-122-2001 |
| Amaxa Cell Line Nucleofector Kit T | Lonza | Cat#VCA-1002 |
| DeadEnd Fluorometric TUNEL System | Promega | Cat#G3250 |
| Deposited Data | ||
| H3K27ac, H3K27me3, H3K4me3, H3K9me3, H3K27me1, H3K36me3, H3K27me2, H2AK119Ub, Pol-II ChIP-seq data of mouse pancreatic islets (Details in Table S4) | This manuscript | GEO: GSE110648 |
| H3K4me1, H3K9me3, H3K27me3 ChIP-seq data of WT mouse pancraetic islets (Details in Table S4) | Hoffman et al., 2010, Tennant et al., 2013 | NCBI: SRA008281; GEO: GSE30298 |
| RNA-seq data of Ctrl and βEedKO mouse islets | This manuscript | GEO: GSE110648 |
| Single cell RNA-seq data of chow and HFD treated mouse islets | This manuscript | GEO: GSE110648 |
| Single cell RNA-seq data of βEedKO mouse islets | This manuscript | GEO: GSE110648 |
| Single cell RNA-seq data of Min6-B1 cell line | This manuscript | GEO: GSE110648 |
| DNA-methylation (WGSBS) data of mouse β cells | Avrahami et al., 2015 | GEO: GSE68618 |
| Human β cell RNA-seq data | Fadista et al., 2014 | GEO: GSE50398 |
| Human β cell H3K4me3, H3K27me3 ChIP-seq data | Bramswig et al., 2013 | GEO: GSE50386 |
| Experimental Models: Cell Lines | ||
| Min6-B1 | Gift from Dr. Philip Halban | N/A |
| Experimental Models: Organisms/Strains | ||
| RIP-cre line (B6.Cg-Tg(Ins2-cre)25Mgn/J) | Gift from Dr. Pedro Herrera | Jax strain #003573; RRID:IMSR_JAX:003573 |
| PDX-1-cre line (STOCK Tg(Pdx1-cre/Esr1∗)#Dam/J) | Gift from Dr. Gerald Gradwohl | Jax strain #024968; RRID:IMSR_JAX:024968 |
| Eedflox/flox line (B6;129S1-Eedtm1Sho/J) | Gift from Dr. Stuart Orkin | Jax strain #022727; RRID:IMSR_JAX:022727 |
| Ezh2flox/flox line (STOCK Ezh2tm2Sho/J) | Gift from Dr. Stuart Orkin | Jax strain #022616; RRID:IMSR_JAX:022616 |
| Mllflox/flox line (Kmt2atm1.1Erns) | Gift from Dr. Patricia Ernst | N/A |
| YFP-reporter line (B6.129X1-Gt(ROSA)26Sortm1(EYFP)Cos/J) | Gift from Dr. Thomas Boehm | Jax strain #006148; RRID:IMSR_JAX:006148 |
| Oligonucleotides | ||
| Cel-seq2 oligodT: GCCGGTAATACGACTC ACTATAGGGAGTTCTACAGTCC GACGA TCNNNNNN[6 base barcode]TTTTTTT TTTTTTTTTTTTTTTTTV |
Hashimshony et al., 2016 | N/A |
| Cel-seq2 RT library primer: GCCTTGGCA CCCGAGAATTCCANNNNNN |
Hashimshony et al., 2016 | N/A |
| Recombinant DNA | ||
| Hoxb7 (NM_010460) Mouse Tagged ORF Clone | Origene | MR223869 |
| Zic1 (NM_009573) Mouse Tagged ORF Clone | Origene | MR207138 |
| Barx1 (NM_007526) Mouse Tagged ORF Clone | Origene | MR222169 |
| Gata2 (NM_008090) Mouse Tagged ORF Clone | Origene | MR226728 |
| Pitx1 (NM_011097) Mouse Tagged ORF Clone | Origene | MR204502 |
| Twist1 (NM_011658) Mouse Tagged ORF Clone | Origene | MR227370 |
| Software and Algorithms | ||
| Prism 7 | Graphpad Software | http://www.graphpad.com; RRID: SCR_002798 |
| ImageJ | Image J | https://imagej.nih.gov/ij/; RRID:SCR_003070 |
| CellProfiler Image Analysis software | Broad Institute | http://cellprofiler.org/;RRID:SCR_003070 |
| GSEA | Broad Institute | http://software.broadinstitute.org/gsea; RRID:SCR_003199 |
| Bowtie2 (v2.2.8) | https://doi.org/10.1038/nmeth.1923 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml; RRID:SCR_005476 |
| DeepTools (v2.4.1) | https://doi.org/10.1093/nar/gkw257 | https://github.com/deeptools/deepTools |
| MACS2 (v2.1.1.20160309) | https://doi.org/10.1186/gb-2008-9-9-r137 | https://github.com/taoliu/MACS; RRID:SCR_013291 |
| TopHat (v2.0.13) | https://doi.org/10.1186/gb-2013-14-4-r36 | http://tophat.cbcb.umd.edu/; RRID:SCR_013035 |
| featureCounts (subread-1.5.0-p1) | https://doi.org/10.1093/bioinformatics/btt656 | http://bioinf.wehi.edu.au/featureCounts; RRID:SCR_012919 |
| edgeR (v3.14) | https://doi.org/10.1093/bioinformatics/btp616 | http://www.bioconductor.org/packages/release/bioc/html/edgeR.html; RRID:SCR_012802 |
| Isolator | https://doi.org/10.1101/088765 | https://github.com/dcjones/isolator |
| DESeq2 (v1.8.1) | http://doi.org/10.1186/s13059-014-0550-8 | http://bioconductor.org/packages/release/bioc/html/DESeq2.html; RRID:SCR_000154 |
| Cutadapt (v1.9.1) | https://doi.org/10.14806/ej.17.1.200 | https://cutadapt.readthedocs.io/en/stable/; RRID:SCR_011841 |
| STAR (v2.5.3.a) | https://doi.org/10.1093/bioinformatics/bts635 | https://github.com/alexdobin/STAR; RRID:SCR_015899 |
| RaceID2/StemID2 | https://doi.org/10.1038/nature14966 | https://github.com/dgrun/RaceID |
| EpicSeg |
Mammana and Chung, 2015 https://doi.org/10.1186/s13059-015-0708-z |
https://github.com/lamortenera/epicseg |
| MethylDackel | MethylDackel | https://github.com/dpryan79/MethylDackel |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.