Table 1.
Oligoa | Sequence (5’-3’) | Location in the gene | Gene | PCR products |
---|---|---|---|---|
FL594F | ATTATGGCCCACACCAGTGGCGC | 2917–2939 | LacZ | 173bp, distalb |
FL594R | TGACGGGCTCCAGGAGTCGTC | 3069–3089 | LacZ | 173bp, distalb |
FL654F | CACCGATCGCCCTTCCCAACAGTTG | 212–236 | LacZ | 172bp, proximalc |
FL654R | GTAGATGGGCGCATCGTAACCG | 362–383 | LacZ | 172bp, proximalc |
FL580F | GCGAGGCTGGATGGCCTTCC | 990–1009 | tet | 176bp, distalb |
FL580R | CCGTGACGATCAGCGGTCCAG | 1145–1165 | tet | 176bp, distalb |
FL657F | GGCCTCTTGCGGGATATCGTCCATTCC | 184–210 | tet | 168bp, proximalc |
FL657R | GATAGTGGCTCCAAGTAGCGAAGCG | 327–351 | tet | 168bp, proximalc |
FL590F | TCCAATTGGCGATGGCCCTGT | 660–680 | GFPuv | 101bp |
FL590R | GGACCATGTGGTCACGCTTTTCGT | 737–760 | GFPuv | 101bp |
FL586F | AGTTATCCCCCTCCATCAGG | 154–135 | 16S rRNA | 99bp |
FL586R | TGCAAGTCGAACGGTAACAG | 56–75 | 16S rRNA | 99bp |
FLXXXF and FLXXXR represent the forward and reverse primers of the PCR reactions, respectively.
Distal indicates the PCR products that locate in the distal region of the gene.
Proximal indicates the PCR products locating in the proximal region of the gene.