Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
ODNs for sgRNA plasmid construction and sequence validation.
| ODN | Sequence | Purpose |
|---|---|---|
| sgRNA-top | CACCGNNNNNNNNNNNNNNNNNNN | Insertion of gene-specific (sense) sgRNA sequence into pSMART-sgRNA |
| sgRNA-bottom | AAACNNNNNNNNNNNNNNNNNNNC | Insertion of gene-specific (antisense) sgRNA sequence into pSMART-sgRNA |
| pSMARTseqF | CAGTCCAGTTACGCTGGAGTC | Sanger sequence verification of cloned sgRNA ODNs |
The G residue in bold indicates the transcription start site.
