Table 1.
Analysis of putative factors affecting editing efficiency at different sgRNA targets
| Promoter | sgRNA | Target gene | Target sequencea | GC% content (without PAM) | Continuous matching between target and sgRNA sequenceb | Editing efficiencyc | Average efficiency |
|---|---|---|---|---|---|---|---|
| AtU3b | S1 | BnCLV3 | AAGCATCATGCAGGAACATGAGG | 45.0% | 3 | 14.4% | 11.0% |
| S4 | BnCLV1 | CGGAGAGATTCTCACTCCCATGG | 55.0% | 0 | 5.0% | ||
| S8 | BnCLV2 | CGGAACGTTCGTTAACCTTAAGG | 45.0% | 5 | 13.5% | ||
| AtU3d | S3 | BnCLV1 | GAGGAGATGGTCCATGTCAGTGG | 55.0% | 8 | 46.5% | 47.6% |
| S7 | BnCLV2 | AACGCGGAGTATCAATAGCGAGG | 50.0% | 5 | 48.7% | ||
| AtU6_1 | S2 | BnCLV3 | GCAAAGGGTCAGGTCCTGAAGGG | 55.0% | 3 | 0.0% | 0.0% |
| S5 | BnCLV1 | TGGATATCTCCGTAACTCTCTGG | 45.0% | 7 | 0.0% | ||
| S9 | BnCLV2 | CTCGTAGCTGAAGGCATTGAAGG | 50.0% | 5 | 0.0% | ||
| AtU6_29 | S6 | BnCLV1 | TCGCCATGTCGAGGACCTCTAGG | 60.0% | 8 | 0.0% | 12.2% |
| S10 | BnCLV2 | GAGATCCCGCTGACTCTAGCCGG | 60.0% | 5 | 24.3% |
a
The PAM is underlined.
b
Counting the maximum number of continuous matching bases between target and sgRNA sequence.
c
The percentage of edited plants over the total number of tested plants for the corresponding targets.