Table 1. Sequences used in this study and binding data obtained from FRET melting (ΔT_m) and fluorescence studies (K_d).

	TH1		TH2		TH3
DNAa	ΔTmb	K d c	ΔTmb	K d c	ΔTmb	K d c
c-MYC14/23: 5′-d(TGAG3TG3TAG3TG3TA2)-3′	2.5	4.81	6.5	2.82	22.0	0.25
c-KIT1: 5′-d(G3AG3CGCTG3AG2AG3)-3′	1.4	5.15	3.7	3.27	9.5	1.17
c-KIT2: 5′-d(G3CG3CGCTAG3AG4)-3′	1.1	20.52	2.5	3.53	7.6	1.34
BCL-2: 5′-d(GGGCGCGGGAGGAATTGGGCGGG)-3′	2.0	9.81	3.9	4.01	7.1	1.22
ds DNA: 5′-d(TATAGCTATA8TATAGCTATA)-3′	1.0	n.d	11.0	0.90	2.0	n.d.

^aThe T_m values of the quadruplexes in 60 mM potassium cacodylate buffer, pH 7.4 in the absence of ligands are: c-MYC14/23 (70±1), BCL-2 (70±1), c-KIT1 (57±1), c-KIT2 (69±1), ds DNA (60±1) °C; maximum measurable T_m = 93 °C. Dual FAM-TAMRA labeled sequences were used in the FRET melting experiments.

^bΔT_m at 1 μM ligand concentration [°C] (ΔT_m = ± 1°C).

^c K _d = ± 10% (expressed in μM).