Table 1.
Structural variations reported for IPN loci
| References | Phenotype | Description | Approximate Size (kb) | Mechanism | HGVS/ISCN (GRCh38/hg38) |
|---|---|---|---|---|---|
| Lupski et al., (1991) | CMT1A | Duplication involving PMP22 | 1,500 | Gene dosage of PMP22 | Chr17:g.(14170534_14194724)_(15567585‐15591587)dup |
| Valentijn et al., (1993) | CMT1A | Duplication involving PMP22 | 450 | Gene dosage of PMP22 | Undetermined |
| Zhang et al., (2010) | CMT1A | Duplication of sequences upstream of PMP22 | 194 | Dysregulation of PMP22 gene expression | Chr17:g.(15467580_15467581)ins(15274153_15467575) |
| Weterman et al., (2010) | CMT1A | Duplication of sequences upstream of PMP22 | 186 | Dysregulation of PMP22 gene expression | Chr17:g.(15485748_15485749)ins(15299622‐15485747) |
| Zhang et al., (2010) | CMT1A | Duplication involving PMP22 | 412 | Gene dosage of PMP22 | Chr17:g.(15624595_15624596)ins(15213043‐15624585) |
| Zhang et al., (2010) | CMT1A | Deletion involving PMP22 | 536 | Gene dosage of PMP22 | Chr17:g.14709310_15245549del |
| Zhang et al., (2010) | CMT1A | Complex rearrangement involving PMP22 | 3,400 | Gene dosage of PMP22 | Undetermined |
| Zhang et al., (2010) | CMT1A | Complex rearrangement involving PMP22 | 1,294 | Gene dosage of PMP22 | Undetermined |
| Chance et al., (1993) | HNPP | Deletion involving PMP22 | 24 | Gene dosage of PMP22 | Chr17:g.(14170534_14194724)_(15567585_15591587)del |
| Nadal et al., (2000) | HNPP | Translocation | Undetermined | Dysregulation of gene expression | t(16;17)(q12;p11.2) |
| Ainsworth et al., (1998) | CMTX1 | Deletion involving GJB1 | Undetermined | Gene dosage of GJB1 | Undetermined |
| Rouger et al., (1997) | CMTX1 | Complex rearrangement involving GJB1 | Undetermined | Undetermined | Undetermined |
| Maeda et al., (2012) | CMT1B | Duplication involving MPZ | 117 | Gene Dosage of MPZ | Chr1:g.(161415803_161415804)ins(161298102_161415774) |
| Brewer et al., (2016) | CMTX3 | Complex Insertion | 78 | Dysregulation of gene expression | ChrX:g.140420783_140420784ins[chr8:g.144542928_144620773;TTCCTTCCT]g.138490706_138490718inv |
| Drew et al., (2016) | DHMN1 | Complex Insertion | 1,350 | Dysregulation of gene expression | Chr7:153636339_153637495delins[GGTGCGGGCTCCT;g.155856471_157199742inv; AGTATGGCTGTAAGTGACGTC |
| Zhang et al., (2010) | CMT1A | Deletion | 17 | Gene dosage of PMP22 | Chr17:g.15234989_15252302delins[CAT] |
| Lin et al., (1999) | CMTX1 | Deletion involving GJB1 | 1.5 | Gene dosage of GJB1 | ChrX:g.71306403_71307859del |
| Nakagawa et al., (2001) | CMTX1 | Deletion involving GJB1 | 1.5 | Gene dosage of GJB1 | ChrX:g.71306977_71307427del |
| Hoyer et al., (2011) | CMT1B | Duplication involving MPZ | 4 | Gene Dosage of MPZ | Chr1:g.161304727_161308898dup |
| Okamoto et al., (2014) | CMT4D | Exonic Duplication involving NDRG1 | 6.25 | Gene Dosage of NDRG1 | Chr8:g.133252822_133259076dup |
| Carr et al., (2015) | CMT2A | Exonic Deletion involving MFN2 | Undetermined | Gene Dosage of MFN2 | Undetermined |
Undetermined = insufficient information provided in published data.