Table 3.
gRNA target sequences used in this study.
| Locus | Target sequence (5΄-3΄) | Position in ORF (bp) | AT score | RNA score |
|---|---|---|---|---|
| KlADE2 | TTTCAATACCTCAAGTGCTTCGG | 508/1710 | 0.65 | 0.70 |
| KmADE2 | GCCCATTTTTCTGCGTATAGCGG | 537/1710 | 0.55 | 0.70 |
| OpADE2* | CTGGAATTGATCTGCTTGGCCGG | 120/1704 | 0.50 | 0.35 |
| OpKU80 | CATCGTTCTGCAGAAGATCATGG | 340/2076 | 0.55 | 0.55 |
| OpYNR1 | AGCACAGACCATAGTAACTGGGG | 397/2580 | 0.55 | 0.55 |
Target sequences are shown including PAM sequence (underlined). The gRNA for OpADE2 targets the respective genes at the same position in both O. polymorpha and O. parapolymorpha. Position in ORF indicates the base pair after which the Cas9-mediated DSB is expected, out of the total length of the ORF. AT score indicates AT content of the 20-bp target sequence. RNA score indicates the fraction of unpaired nucleotides of the 20-bp target sequence, predicted with the complete gRNA sequence using minimum free energy prediction by RNAfold (Lorenz et al.2011).
*The same sequence was used for single (pUDP013) and for double (pUDP123) editing.