Table 1. Bacterial strains and plasmids.

^aThe core rrnB P1 promoter fragment in RLG3097 and pRLG4210 differs from that present in RLG2263 due to the presence of the SUB sequence (GACTGCAGTGGTACCTAGGAAT) from –38 to –59 and rrnB P1 sequences from –60 to –66 in the former. RLG2263 retains rrnB P1 sequences up to position –41 and does not contain the SUB sequence.

^bThe consensus UP element present in RLG4192 and pRLG3278 has the sequence GGAAAATTTTTTTTCAAAAGTA (–59 to –38) and retains rrnB P1 promoter sequences from –60 to –66. The consensus UP element in RLG4721 and pRLG4713 has the sequence GGAAAATTTTTTTTAAAAAAGA (–59 to –38) and does not retain additional upstream rrnB P1 sequences.

^cAll plasmids encode resistance to ampicillin.