Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | SLC37A3 | NA | NCBI: 84255 | |
| Gene (Mus musculus) | Slc37a3 | NA | NCBI: 72144 | |
| Gene (H. sapiens) | ATRAID | NA | NCBI: 51374 | |
| Cell line (H. sapiens) | K562 | ATCC | ATCC: CCL-243, RRID:CVCL_0004 | |
| Cell line (H. sapiens) | HEK 293T | ATCC | ATCC: CRL-3216, RRID:CVCL_0063 | |
| Cell line (M. musculus) | RAW 264.7 | ATCC | ATCC: TIB-71, RRID:CVCL_0493 | |
| Cell line (H. sapiens) | K562 SLC37A3 knock-out | this paper | SLC37A3 was deleted by removing exon 6 | |
| Cell line (H. sapiens) | HEK 293T SLC37A3 knock-out | this paper | SLC37A3 was deleted by removing exon 6 | |
| Cell line (H. sapiens) | K562 ATRAID knock-out | this paper | ATRAID was deleted by trucating exon 3, 4 and 5 | |
| Cell line (H. sapiens) | HEK 293T ATRAID knock-out | this paper | ATRAID was deleted by trucating exon 3, 4 and 5 | |
| Cell line (H. sapiens) | HEK 293T KO2 (double knock-out) | this paper | ATRAID was deleted in the SLC37A3 knockout background | |
| Cell line (M. musculus) | RAW Slc37a3 knock-out | this paper | Slc37a3 was deleted by introducing microdeletions in exon 2 | |
| Transfected construct (H. sapiens) | HEK 293T SLC37A3KO + SLC37A3-HA | this paper | An HA-tagged SLC37A3 CDS under PGK promoter was integrated in to the AAVS1 expression harbor inSLC37A3 knockout background | |
| Transfected construct (H. sapiens) | HEK 293T ATRAIDKO + s/lATRAID-V5 | this paper | A V5-tagged short/long ATRAID CDS under PGK promoter was integrated in to the AAVS1 expression harbor in ATRAID knockout background | |
| Transfected construct (H. sapiens) | HEK 293T KO2 + SLC37A3-HA | this paper | An HA-tagged SLC37A3 CDS under PGK promoter was integrated in to the AAVS1 expression harbor in double knockout background | |
| Transfected construct (H. sapiens) | HEK 293T KO2 + SLC37A3-HA + s/lATRAID-V5 | this paper | letiviral vectors containing V5-tagged short/long ATRAID CDS under PGK promoter was transduced intoKO2 + SLC37A3-HA background | |
| Antibody | anti-HA (rat mAb) | Sigma-Aldrich | Sigma-Aldrich: 11867423001, RRID:AB_390918 | |
| Antibody | anti-V5 (rabbit mAb) | Cell Signaling Technology | Cell Signaling Technology: 13202, RRID:AB_2687461 | |
| Antibody | anti-V5 (mouse mAb) | ThermoFisher | ThermoFisher: R960-25, RRID:AB_2556564 | |
| Antibody | anti-LAMP2 (mouse mAb) | Santa Cruz Biotechnology | Santa Cruz: sc-18822, RRID:AB_626858 | |
| Antibody | anti-ATP1A1 (mouse mAb) | Abcam | Abcam: ab7671, RRID:AB_306023 | |
| Antibody | anti-Rap1A (goat pAb) | Santa Cruz Biotechnology | Santa Cruz: sc-1482 | This item has been discontinued due to animal welfare concerns |
| Antibody | anti-HDJ2 (mouse mAb) | ThermoFisher | ThermoFisher: MS-225-P0, RRID:AB_10982482 | |
| Antibody | anti-GAPDH (rabbit mAb) | Cell Signaling Technology | Cell Signaling Technology: 2118, RRID:AB_561053 | |
| Recombinant DNA reagent | pSpCas9(BB)−2A-GFP | Addgene | Addgene: 48138 | |
| Recombinant DNA reagent | AAVS1-Puro-PGK1−3 × FLAG-TwinStrep | Addgene | Addgene: 68375 | |
| Recombinant DNA reagent | pLenti PGK Hygro DEST (w530-1) | Addgene | Addgene: 19066 | |
| Recombinant DNA reagent | AAVS1-Puro-PGK1-SLC37A3-HA | this paper | The FLAG-TwinStrep sequence in AAVS1-Puro-PGK1−3 × FLAG TwinStrep was replaced with an HA-tagged SLC37A3 CDS. | |
| Recombinant DNA reagent | AAVS1-Puro-PGK1-s/lATRAID-V5 | this paper | The FLAG-TwinStrep sequence in AAVS1-Puro-PGK1−3 × FLAG TwinStrep was replaced with an V5-tagged short/long ATRAID CDS. | |
| Recombinant DNA reagent | pLenti PGK Hygro s/lATRAID-V5 | this paper | A V5-tagged short/long ATRAID CDS was inserted under the PGK promoter for lentiviral expression | |
| Sequence-based reagent | sgRNA_human_ATRAID_exon3_1 | this paper | sequence: GCCTGATGAAAGTTTGGACC | a sgRNA targeting exon 3 of ATRAID for generating knock-out cells |
| Sequence-based reagent | sgRNA_human_ATRAID_exon3_2 | this paper | sequence: CCCTGGTCCAAACTTTCATC | a sgRNA targeting exon 3 of ATRAID for generating knock-out cells |
| Sequence-based reagent | sgRNA_human_ATRAID_exon5 | this paper | sequence: GTCCTGGAGGAATTAATGCC | a sgRNA targeting exon 5 of ATRAID for generating knock-out cells |
| Sequence-based reagent | sgRNA_human_SLC37A3_intron5_1 | this paper | sequence: GTGTGAGTGTATCCTTCACG | a sgRNA targeting intron 5 of SLC37A3 for generating knock-out cells |
| Sequence-based reagent | sgRNA_human_SLC37A3_intron5_2 | this paper | sequence: GCCAGTGCCTGTAAGTCACG | a sgRNA targeting intron 5 of SLC37A3 for generating knock-out cells |
| Sequence-based reagent | sgRNA_human_SLC37A3_intron6 | this paper | sequence: GTAGCAAGTCAGAGTTGTTCA | a sgRNA targeting intron 6 of SLC37A3 for generating knock-out cells |
| Sequence-based reagent | sgRNA_mouse_ SLC37A3_exon1_1 | this paper | sequence: TCTCTGCAAAAATCGTGGCC | a sgRNA targeting exon 2 of SLC37A3 for generating knock-out cells |
| Sequence-based reagent | sgRNA_mouse_SLC37A3_exon1_2 | this paper | sequence: TGTTCCTGCTCACGTTCTTC | a sgRNA targeting exon 2 of SLC37A3 for generating knock-out cells |
| Peptide, recombinant protein | HA peptide | ThermoFisher | ThermoFisher: 26184 | |
| Peptide, recombinant protein | V5 peptide | APExBIO | APExBIO: A6005 | |
| Commercial assay or kit | CellTiter-Glo | Promega | Promega: G7572 | |
| Commercial assay or kit | anti-HA affinity matrix | Sigma-Aldrich | Sigma-Aldrich: A2095 | |
| Commercial assay or kit | anti-V5 affinity matrix | Sigma-Aldrich | Sigma-Aldrich: A7345 | |
| Chemical compound, drug | alendronate | Sigma-Aldrich | Sigma-Aldrich: A4978 | |
| Chemical compound, drug | zoledronate | Sigma-Aldrich | Sigma-Aldrich: SML0223 | |
| Chemical compound, drug | ibandronate | Sigma-Aldrich | Sigma-Aldrich: I5784 | |
| Chemical compound, drug | lovastatin | Sigma-Aldrich | Sigma-Aldrich: PHR1285 | |
| Chemical compound, drug | AlexaFlour 647 labeled zoledronate | BioVinc | BioVinc: AF647-ZOL | |
| Chemical compound, drug | digitonin | Millipore-Sigma | Millipore-Sigma:300410 | |
| Chemical compound, drug | saponin | Sigma-Aldrich | Sigma-Aldrich: 47036 | |
| Software, algorithm | Huygens Professional | Scientific Volume Imaging | RRID:SCR_014237 |