Table 2.
Details about the primers, PCR conditions and expected size of amplicon
| Primer | Reaction mixture | PCR conditions | Size of amplicon |
|---|---|---|---|
| hrpB gene | |||
| Forward: 5′-GCGAGGAAAGTCCGACGACTA-3′ Reverse: 5′-CGCAGCAGGCTGAGGTATTC-3′ |
20 μL reaction mixture contained 1.0 µM of each primer, 200 μM dNTPs, 1× assay buffer, 10% DMSO, 20 μg BSA, 0.5U Taq DNA polymerase and 50 ng of the DNA template | Initial denaturation of 94 °C for 5 min; 30 cycles of 94 °C for 30 s, 68 °C for 30 s, 72 °C for 30 s and final extension of 10 min at 72 °C | 582 bp |
| Diagnostic: 5′-CACCAACGACCAGATGC-3′ M13 forward: 5′- GTAAAACGACGGCCAGT-3′ |
20 μL reaction mixture contained 0.5 µM of each primer, 200 μM dNTPs, 1× assay buffer, 3% DMSO, 20 μg BSA, 0.5U Taq DNA polymerase and 50 ng µl of the DNA template | Initial denaturation of 94 °C for 5 min; 30 cycles of 94 °C for 30 s, 66 °C for 30 s, 72 °C for 1 min 30 s and final extension of 10 min at 72 °C | 1628 bp |
| hrcV gene | |||
| Forward: 5′- GCTGATGGTGCTGCCGCTGCC -3′ Reverse: 5′-GGACAGCTGCCGCACGATCTC -3′ |
20 μL reaction mixture contained 0.5 µM of each primer, 200 μM dNTPs, 1× assay buffer, 5% DMSO, 20 μg BSA, 0.5U Taq DNA polymerase and 50 ng of the DNA template | Initial denaturation of 94 °C for 5 min; 30 cycles of 94 °C for 30 s, 68 °C for 1 min 15 s and final extension of 10 min at 72 °C | 763 bp |
| Diagnostic: 5′- GGACGAAGTCAAGCGCGAGC -3′ M13 reverse: 5′- CAGGAAACAGCTATGAC-3′ |
20 μL reaction mixture contained 0.5 µM of each primer, 200 μM dNTPs, 1X assay buffer, 3% DMSO, 20 μg BSA, 0.5U Taq DNA polymerase and 50 ng of the DNA template | Initial denaturation of 94 °C for 5 min; 30 cycles of 94 °C for 30 s, 64 °C for 30 s, 72 °C for 1 min 30 s and final extension of 10 min at 72 °C | 1624 bp |