Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used to construct the MAP1203 dominant negative expression vectors.
| Primer Name | Sequence (5′-3′) |
|---|---|
| 1203XbaIFwd | gtgtctagaatgagacgcacacgctgg |
| 1203XbaIRev | gtgtctagaccactcgatgtaacggacc |
| MAP1203_RGDmu_B | gatgacttcgcagcggcgcat |
| MAP1203_RGDmu_C | atgcgccgctgcgaagtcatc |
| MAP1203_SSmu_B | ggcgacgggatccctcgcggccggccgcgcggaag |
| MAP1203_SSmuC | ccggccgcgagggatcccgtcgccgacaacctgg |
| MAP1203_pETHindIII_Fwd | gtgaagcttaagaatgagacgcacacgctgg |
| MAP1203_pETEcoRI_Rev | gtggaattcccactcgatgtaacggacc |
