Skip to main content
. 2018 Jun 4;14(6):e1007092. doi: 10.1371/journal.ppat.1007092

Table 1. Common targets in the rice genome for TAL effectors from strains MAI1 and BAI3.

TAL effector groupa Target locus IDb EBE distance to TSSc EBEd EBE rank MAI1e EBE rank BAI3f Annotationg Fold change MAI1 vs. H20h Fold change BAI3 vs. H20i EBE strandj
TalA Os05g40890 -139 TACACCATCCATCCATCCATCCATCGT 1 1 expressed protein 3,62 2,12 +strand
TalA Os08g18974 -498 TCTCTCACACACGCATATATAAATTGT 157 103 expressed protein 3,91 3,20 +strand
TalA Os04g03850 -436 TATAACAATAATGAAAATACTAATCAT 331 184 OsSub39—Putative Subtilisin homologue, expressed 2,29 2,88 +strand
TalB Os09g39810 -347 TGCGATGCGTTTCCCACCTCCCACCTC 30 6 AP2 domain containing protein, expressed 6,05 4,73 +strand
TalB Os09g29820 -134 TAAAAGGCCCTCACCAACCCATCGCCT 570 135 bZIP transcription factor domain containing protein, expressed 4,37 4,55 +strand
TalC Os11g31190 -319 CATGCATGTCAGCAGCTGGTCAT 1 1 nodulin MtN3 family protein, putative, expressed 6,46 4,31 +strand
TalC Os03g58790 -88 TTTCCATATCCATATCCACCCAT 264 264 ATPase, putative, expressed 1,97 4,01 +strand
TalD Os03g61760 -537 TACGCGTCCCCATCCCATCCCCC 3 3 OsSPL6—SBP-box gene family member, expressed 3,73 2,81 +strand
TalD Os01g72009 -614 TACAACTTTCCATCACATCAAAC 227 227 expressed protein 2,00 1,15 +strand
TalE Os02g48740 -352 CACCACTTCCCCTCCCCTCT 8 8 fimbrin-like protein 2, putative, expressed 2,57 1,86 +strand
TalE Os06g04540 -108 TAACCCTTCTCCTCTCCTCT 138 138 DNA binding protein, putative, expressed 3,77 3,99 +strand
TalE Os07g46340 -45 TGCCGATGCTCCTCCCACCT 238 238 methyltransferase, putative, expressed 2,50 2,49 +strand
TalE Os09g39810 -365 TGCCGAATCTTCCCCCCCCT 478 478 AP2 domain containing protein, expressed 6,05 4,73 -strand
TalF Os11g31190 -235 TAAGCTCATCAAGCCTTCA 5 >2000 nodulin MtN3 family protein, putative, expressed 6,46 4,31 +strand
TalF Os08g06210 -158 TGCGCCCCCCAGGCCCCCA 61 16 expressed protein 1,94 1,18 +strand
TalG Os01g53420 -73 TAGAAAACATCATCTCAT 369 369 anthocyanidin 5,3-O-glucosyltransferase, putative, expressed 4,59 4,05 +strand
TalH Os05g41420 -170 TGCCCATAAACCCTATA 1 129 auxin-induced protein 5NG4, putative, expressed 5,86 4,70 +strand
TalH Os01g72009 -288 TGCGCATAGGACATACA 37 449 expressed protein 2,00 1,15 +strand

aIdentifier of the TAL effector group; corresponds to both the MAI1 and the BAI3 allele.

bNipponbare MSU7 gene ID; genes that are significantly induced by both MAI1 and BAI3 strains and contain a predicted EBE in their promoters for TAL effectors from both strains are shown. Prefix “LOC_Os” is omitted.

cDistance from the leftmost base of the EBE to the annotated translation start site based on cDNA evidence in the Rice Genome Annotation Project Release 7 (http://rice.plantbiology.msu.edu/).

dPredicted TAL effector binding sequence for each TAL effector group. The 5’ terminal nucleotide of each target box indicated in bold.

eRank (according to prediction score) of the EBE among the predicted binding sites in all the Nipponbare MSU7 genome for the MAI1 allele of the corresponding TAL effector group.

fRank (according to prediction score) of the EBE among the predicted binding sites in all the Nipponbare MSU7 genome for the BAI3 allele of the corresponding TAL effector group.

gGene annotation in the Rice Genome Annotation Project Release 7.

hLog2 fold change of the corresponding gene in microarray data when comparing plants inoculated with X. oryzae pv. oryzae strain MAI1 vs water control at 24 hpi.

iLog2 Fold change of the corresponding gene in RNAseq data when comparing plants inoculated with X. oryzae pv. oryzae BAI3 vs water control at 24 hpi.

jStrand on the promoter where the EBE was predicted “+ strand” indicates the EBE is in 5’ to 3’ orientation in the sense strand of the gene"