Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (human) |
human peripheral blood mononuclear cells |
human | donor # 1–237 | |
| Antibody | W6/32 (anti-HLA-A,B,C) |
mouse hybridoma, UMICH Hybridoma PMID: 667938 |
W6/32 | mouse hybridoma purified with Protein G column and labeled with FITC |
| Antibody | HC10 (anti-HLA-heavy chain) |
mouse hybridoma UMICH Hybridoma PMID: 2088481 |
HC10 | mouse hybridoma purified with Protein G column and labeled with FITC |
| Antibody | PaSta-1 (anti-tapasin antibody) |
Received from Dr. Peter Cresswell Yale University PMID: 11825568 |
PaSta-1 | anti-tapasin antibody (received purified) and labeled with FITC |
| Antibody | anti-Bw4 FITC | One Lambda | Fisher:FH0007 | (1:20) (1:10) |
| Antibody | anti-Bw6 FITC | One Lambda | Fisher:FH0038 | (1:20) (1:10) |
| Antibody | IgG3 mouse isotype control FITC |
Abcam | ab91539 | (1:10) |
| Antibody | IgG2a mouse isotype control FITC |
Abcam | ab91362 | (1:10) |
| Antibody | anti-CD3 UCHT1 pacific blue |
Biolegend | RRID:AB_2562048
(BioLegend Cat. No. 300442) |
(1:50) |
| Antibody | anti-CD4 RPA-T4 PE/Cy7 |
Biolegend | RRID:AB_314086
(BioLegend Cat. No. 300518) |
(1:50) |
| Antibody | anti-CD8 SK1 Alexa Fluor 700 |
Biolegend | RRID:AB_2562790
(BioLegend Cat. No. 344724) |
(1:50) |
| Antibody | anti-CD14 63D3 Alexa Fluor 700 |
Biolegend | RRID:AB_2566716
(BioLegend Cat. No. 367114) |
(1:50) |
| Antibody | anti-CD19 HIB19 APC |
Biolegend | RRID:AB_314242
(BioLegend Cat. No. 302212) |
(1:20) |
| Antibody | anti-CD33 P67.6 PE/Cy7 |
Biolegend | RRID:AB_2566416
(BioLegend Cat. No. 366614) |
(1:50) |
| Antibody | anti-CD56 5.1H11 APC/Cy7 | Biolegend | RRID:AB_2563927
(BioLegend Cat. No. 362510) |
(1:50) |
| Antibody | anti-HLA-DR L243 BV650 |
Biolegend | RRID:AB_2563828
(BioLegend Cat. No. 307650) |
(1:50) |
| Antibody | mouse anti-AP-1 | Sigma Aldrich | RRID:AB_476720
(Sigma-Aldrich Cat# A4200) |
(1:500) |
| Antibody | goat anti-mouse IgG2b -Alexa Fluor 568 |
Thermo Fisher | RRID:AB_2535780
(Thermo Fisher Scientific Cat# A-21144) |
(1:500) |
| Antibody | anti-calreticulin (CRT) | Thermo Fisher | RRID:AB_325990
(Thermo Fisher Scientific Cat# PA3-900) |
(1:500) |
| Antibody | goat anti-rabbit IgG-Alexa Fluor 594 |
Cell Signaling Technology |
RRID:AB_2716249
(Cell Signaling Technology Cat# 8889) |
(1:500) |
| Antibody | PE mouse anti-human CD107a (LAMP-1) |
BD Biosciences | RRID:AB_396135
(BD Biosciences Cat# 555801) |
(1:20) |
| Sequence-based reagent |
HLA-B reverse primer 5’ TCAAGCTGTGAGAGACACAT 3’ |
PMID: 20842357 | ||
| Sequence-based reagent |
HLA-B forward primer 5’ TCCTAGCAGTTGTGGTCATC 3’ |
PMID: 20842357 | ||
| Sequence-based reagent |
pan-Class I forward primer 5’ GAGATCACACTGACCTGGCA 3’, |
This paper | Primer chosen by sequence alignment |
|
| Sequence-based reagent |
pan-Class I reverse primer 5’ GAACCTTCCAGAAGTGGG 3’ |
This paper | Primer chosen by sequence alignment |
|
| Sequence-based reagent |
ACTB forward primer 5' GGACTTCGAGCAAGAGATGG 3' |
RealTime Primers.com |
VHPS-110 | |
| Sequence-based reagent |
ACTB reverse primer 5' AGCACTGTGTTGGCGTACAG 3' |
RealTime Primers.com |
VHPS-110 | |
| Sequence-based reagent |
GAPDH forward primer 5' GAGTCAACGGATTTGGTCGT 3' |
RealTime Primers.com |
VHPS-3541 | |
| Sequence-based reagent |
GAPDH reverse primer 5' TTGATTTTGGAGGGATCTCG 3' |
RealTime Primers.com |
VHPS-3541 | |
| Sequence-based reagent |
HPRT1 forward primer 5' TGACACTGGCAAAACAATGCA 3' |
RealTime Primers.com |
VHPS-4263 | |
| Sequence-based reagent |
HPRT1 reverse primer 5' GGTCCTTTTCACCAGCAAGCT 3' |
RealTime Primers.com |
VHPS-4263 | |
| Peptide, recombinant protein |
HSKKKCDEL | Synthetic Biomolecules (A and A labs LLC) |
HSK | Peptide chosen from IEDB |
| Peptide, recombinant protein |
HSDYECDE | Synthetic Biomolecules (A and A labs LLC) |
HSD | Peptide modified from HSK |
| Peptide, recombinant protein |
GPKVKRPPI | Synthetic Biomolecules (A and A labs LLC) |
GPK | Peptide chosen from IEDB |
| Peptide, recombinant protein |
GPDVERPP | Synthetic Biomolecules (A and A labs LLC) |
GPD | Peptide modified from GPD |
| Peptide, recombinant protein |
QIKVRVDMV | Synthetic Biomolecules (A and A labs LLC) |
QIK | Peptide chosen from IEDB |
| Peptide, recombinant protein |
QIDVEVDM | Synthetic Biomolecules (A and A labs LLC) |
QID | Peptide modified from QID |
| Peptide, recombinant protein |
HPVGEADYFEY | Synthetic Biomolecules (A and A labs LLC) |
HPV | Peptide chosen from IEDB |
| Peptide, recombinant protein |
HGVGEADYFE | Synthetic Biomolecules (A and A labs LLC) |
HGV | Peptide modified from HPV |
| Peptide, recombinant protein |
EPLPQGQLTAY | Synthetic Biomolecules (A and A labs LLC) |
EPL | Peptide chosen from IEDB |
| Peptide, recombinant protein |
EGLPQGQLTA | Synthetic Biomolecules (A and A labs LLC) |
EGL | Peptide modified from EPL |
| Peptide, recombinant protein |
HPNIEEVAL | Synthetic Biomolecules (A and A labs LLC) |
HPN | Peptide chosen from IEDB |
| Peptide, recombinant protein |
HGNIEEVA | Synthetic Biomolecules (A and A labs LLC) |
HGN | Peptide modified from HGN |
| Peptide, recombinant protein |
RPPIFIRRL | Synthetic Biomolecules (A and A labs LLC) |
RPPI | Peptide chosen from IEDB |
| Peptide, recombinant protein |
RKPIFIRR | Synthetic Biomolecules (A and A labs LLC) |
RKPI | Peptide modified from RKPI |
| Peptide, recombinant protein |
QPRAPIRPI | Synthetic Biomolecules (A and A labs LLC) |
QPRA | Peptide chosen from IEDB |
| Peptide, recombinant protein |
QKRAPIRP | Synthetic Biomolecules (A and A labs LLC) |
QKRA | Peptide modified from QKRA |
| Peptide, recombinant protein |
TPRVTGGGAM | Synthetic Biomolecules (A and A labs LLC) |
TPRV | Peptide chosen from IEDB |
| Peptide, recombinant protein |
TKRVTGGGA | Synthetic Biomolecules (A and A labs LLC) |
TKRV | Peptide modified from TKRV |
| Commercial assay or kit |
DNeasy Blood and Tissue Kit |
Qiagen | Qiagen:69504 | |
| Commercial assay or kit |
RNeasy Mini Kit | Qiagen | Qiagen:74104 | |
| Commercial assay or kit |
Quantum™ Simply Cellular anti-Mouse IgG |
Bangs Lab | Bangs Lab:815A | |
| Chemical compound, drug |
Brefeldin A | Sigma Aldrich | Sigma-Aldrich:B7651 | |
| Chemical compound, drug |
FITC | Thermo Fisher | Fisher:46424 | |
| Software, algorithm |
FlowJo Version 10 | FlowJo, LLC | RRID:SCR_008520 | |
| Software, algorithm |
Prism 7 | GraphPad Software | RRID:SCR_002798 |