Table 3.

Novel miRNAs identification from the tube foot of S. intermedius.

Novel_miRNA	Sequences (5′-3′)	Length	Mean readcount	Mean TPM
novel_137	uuaauacacuuguggcucca	20	5.00	2.43
novel_98	uguaaaaauguguagaacagg	21	18.67	10.03
novel_181	aauccgguccuagaagcaaga	21	41.33	20.34
novel_50	aaauacuggcccuucuauuacc	22	2.00	1.04
novel_79	uccguuucguugacgaucagcc	22	2.33	1.12
novel_121	uuuuccgucucuuucguucguu	22	2.67	1.35
novel_147	auggggccuguaucacgacuau	22	3.00	1.42
novel_87	uuuucacaaagugacgguagug	22	3.33	1.66
novel_45	aaauuuguagcggcguuguagc	22	4.67	2.41
novel_39	auggccgucgcgcuguuggagu	22	6.67	3.80
novel_194	ucgacaucucuucaaacgcgug	22	11.67	6.67
novel_70	uugacuaucccauugaaacgug	22	13.33	6.91
novel_134	uggugucugucugcaugcuacu	22	28.67	15.78
novel_20	uuucacacuggucuagacaagg	22	84.67	44.86
novel_202	cugauugucaacgaaacggagu	22	127.00	63.95
novel_7	ugagguaguagguuguauaguu	22	36356.00	18847.28
novel_118	uuuguucguucggcucgcgucau	23	327.33	169.86
novel_8	uaaugcugucuggugaugauguu	23	35236.00	18243.18
novel_163	acaauggucguuggcaguguaccu	24	6.33	3.16
novel_113	aaggacaucagggugcaacugcca	24	9.67	5.54

miRNA expression levels were estimated by TPM (transcript per million) through the Normalization formula: Normalized expression = mapped read count/Total reads*1000000.